TkA05G398850 | RubberDandelionOmics

Gene overview

TkA05G398850

Reference: TK1151 Chr: Chr05 Coordinates: 99163137-99172881 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2895 bp · TkA05G398850|TK1151|cDNA

AATATATGTACCAGCGTCTTTTATGCTGATTAAAAGGCCACCGTTCACCATAAGAATGCAAACCACCGCCACCATCACCATCATCGGCGCCAGCCTTCACCACCACCGTCATCACCAACCTCCACCACCACCGCCACCCTAATCATCAACTAGCTAGCTTCACCACCAGCATGATGGTATGGGGGTATGTGATCCCTGTATTGGTGGTTTTTATATACATAGCAAAGTCTGTGAATTTGAAAAGAAACAAGGATAAGCTG...

CDS

Download CDS FASTA

1425 bp · TkA05G398850|TK1151|CDS

ATGATGGTATGGGGGTATGTGATCCCTGTATTGGTGGTTTTTATATACATAGCAAAGTCTGTGAATTTGAAAAGAAACAAGGATAAGCTGCCGCCGGGAGGAAGAGGGTGGCCGGTAGTTGGGGATAGCATCAGTTGGTATAATTCTGTTTCAAGCTCTCATCCTGCTACGTTTGTTCAACAGCAAGCTTTAAGGTATGGAAAGATATTCTCGTGCAATATATTTGGAAGAAGGGCAGTGGTATCAATTGATCCAATTTT...

Protein

Download Protein FASTA

474 aa · TkA05G398850|TK1151|PROTEIN

MMVWGYVIPVLVVFIYIAKSVNLKRNKDKLPPGGRGWPVVGDSISWYNSVSSSHPATFVQQQALRYGKIFSCNIFGRRAVVSIDPIFNRYVMHNEGKLFKSSYPKSFRDLVGTNGVITAQGDQHRKLHTIASIMMRTDTLKSRFLIDIQLVMHQTFANFHHNDTILLQDVCRKLAINLMVNQLLGVSSETEVGEMAQLFSTFVDGCLSLPISFPGFAYHTAMNARNNITRKIKKIIVETRNGVSDGDGGLVGRLVEEGSL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G398850`
TK1151 ID	TkA05G398850
OH-1004 ID	LXL04_002142
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	34.400
Protein coverage (%)	TK1151 92.827 / OH-1004 86.220 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G398850

Location Chr05:99163137-99172881 (+)

Description Similar to CYP90D1: 3-epi-6-deoxocathasterone 23-monooxygenase CYP90D1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g50660`	Catalyzes the C22-alpha-hydroxylation step in brassinosteroids biosynthesis.	Arabidopsis CYP90B1 catalyses the early C-22 hydroxylation of C27, C28 and C29 sterols.2006 · DOI: 10.1111/j.1365-313x.2005.02639.x The DWF4 gene of Arabidopsis encodes a cytochrome P450 that mediates multiple 22alpha-hydroxylation steps in brassinosteroid biosynthesis.1998 · DOI: 10.1105/tpc.10.2.231
`At3g13730`	Involved in brassinosteroid (BR) biosynthesis.	CYP90C1 and CYP90D1 are involved in different steps in the brassinosteroid biosynthesis pathway in Arabidopsis thaliana.2005 · DOI: 10.1111/j.1365-313x.2004.02330.x C-23 hydroxylation by Arabidopsis CYP90C1 and CYP90D1 reveals a novel shortcut in brassinosteroid biosynthesis.2006 · DOI: 10.1105/tpc.106.045443

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0227700`	Catalyzes the C22-alpha-hydroxylation step in brassinosteroid biosynthesis, which is the rate-limiting step in this biosynthetic pathway.	Erect leaves caused by brassinosteroid deficiency increase biomass production and grain yield in rice.2006 · DOI: 10.1038/nbt1173 Involvement of C-22-hydroxylated brassinosteroids in auxin-induced lamina joint bending in rice.2009 · DOI: 10.1093/pcp/pcp106

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002142 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009965 leaf morphogenesis Biological Process

GO:0010268 brassinosteroid homeostasis Biological Process

GO:0016125 sterol metabolic process Biological Process

GO:0016132 brassinosteroid biosynthetic process Biological Process

GO:0042814 monopolar cell growth Biological Process

GO:0048366 leaf development Biological Process

GO:0048441 petal development Biological Process

GO:0048443 stamen development Biological Process

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0005506 iron ion binding Molecular Function

KEGG gene cross-reference

ath:AT3G13730

ath:AT4G36380

bdi:100839691

dosa:Os01g0197100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.900

Rank 1 · TkA05G398850 · TK1151

Golgi apparatus0.036

Rank 2 · TkA05G398850 · TK1151

Nucleus0.035

Rank 3 · TkA05G398850 · TK1151

Cytoplasm0.033

Rank 4 · TkA05G398850 · TK1151

Cell membrane0.032

Rank 5 · TkA05G398850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00067p45031-454 aa

PF14542Acetyltransf_CG321-376 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G398850	`PF00067`	p450	31	454	2.2e-59	202.2
TkA05G398850	`PF14542`	Acetyltransf_CG	321	376	0.097	13.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O64989`	Arabidopsis thaliana	sp\|O64989\|C90B1_ARATH Steroid (22S)-hydroxylase	34.100%	Swiss-Prot	Medium
`Q94IA6`	Arabidopsis thaliana	sp\|Q94IA6\|C90D1_ARATH 3-epi-6-deoxocathasterone 23-monooxygenase CYP90D1	34.500%	Swiss-Prot	Medium
`Q5CCK3`	Oryza sativa subsp. japonica	sp\|Q5CCK3\|C90B2_ORYSJ Steroid (22S)-hydroxylase	37.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card