TkA05G395390 | RubberDandelionOmics

Gene overview

TkA05G395390

Reference: TK1151 Chr: Chr05 Coordinates: 98296650-98298731 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1838 bp · TkA05G395390|TK1151|cDNA

TAAAAATATAAAACAAATAAAACGTTGCAATCTGCAAACTTTCTCTAATTTGGACGGCAGCACATCTGCCCTATCAGACCAAATCCATGATTACAATTTATAACTCAAGATAATGACGCATATCAGACTAAAATATAGCATGTGAGCTTTGGGCCGGCAACTAAAATGTCACTGTCAAAAAGACACAAGTTTCTGGTTGTTTTAAACTGCTATATATCATGCAAACGGGTGTCTCTTGGATTCTGAGATCGGATTTAGCC...

CDS

Download CDS FASTA

1263 bp · TkA05G395390|TK1151|CDS

ATGGCTTCTTTCTCGATGGAAGATTTTGTGGGAACTGGCTCTTTAAAGAAGCTTCTTCCAAAACTGCTAGATGATGGCTGGGATGATGTTCCAACTTTGAAGATAATGAATACAGAAGACATGACTGCAATCAACATGAATCAAACACAGAAAGATGCATTGGAGATAAGGTCATACCTCCATGATCGATCACTAATGCAATACGCAGATAAGCTAGAAGCTTCAGGGAAATGTCTAGCAGAGCTTTTAAACCTCGGGAT...

Protein

Download Protein FASTA

420 aa · TkA05G395390|TK1151|PROTEIN

MASFSMEDFVGTGSLKKLLPKLLDDGWDDVPTLKIMNTEDMTAINMNQTQKDALEIRSYLHDRSLMQYADKLEASGKCLAELLNLGISDLSSQFAMKRGHIARFMDRTSQCEADPIPSSFSLPARKPTNRQYSRNHSNSTFKNPSMSARPKLQTMSTRSTVAYDATIEQSIADFKIKDGYIFKGVVAALPDEPRACGCIQPPPIVDDVAPYSSIETISVQKLTPEYKIGMERLVTTKTPPMRVSDLWRDKPSLLLCIRRP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G395390`
TK1151 ID	TkA05G395390
OH-1004 ID	LXL04_012647
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	27.100
Protein coverage (%)	TK1151 37.143 / OH-1004 55.944 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G395390`
Location	Chr05:98296650-98298731 (+)
Description	Similar to At2g37240: Thioredoxin-like protein AAED1, chloroplastic
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_012647` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0045821 positive regulation of glycolytic process Biological Process GO:0070374 positive regulation of ERK1 and ERK2 cascade Biological Process GO:0005576 extracellular region Cellular Component GO:0005829 cytosol Cellular Component GO:0009507 chloroplast Cellular Component GO:0016616 oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor Molecular Function GO:0047017 prostaglandin F synthase activity Molecular Function
KEGG gene cross-reference	ath:AT2G37240 bta:616897 hsa:195827 mmu:66129 sasa:106582827 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.283

Rank 1 · TkA05G395390 · TK1151

Cytoplasm0.274

Rank 2 · TkA05G395390 · TK1151

Nucleus0.152

Rank 3 · TkA05G395390 · TK1151

Plastid0.140

Rank 4 · TkA05G395390 · TK1151

Endoplasmic reticulum0.112

Rank 5 · TkA05G395390 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08534Redoxin235-323 aa

PF00578AhpC-TSA238-298 aa

PF13911AhpC-TSA_2272-386 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G395390	`PF08534`	Redoxin	235	323	0.1	13.1
TkA05G395390	`PF00578`	AhpC-TSA	238	298	0.0071	17.0
TkA05G395390	`PF13911`	AhpC-TSA_2	272	386	1.4e-23	84.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card