LXL04_012647 | RubberDandelionOmics

Gene overview

LXL04_012647

Reference: OH-1004 Chr: Chr03 Coordinates: 16229410-16230846 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

861 bp · LXL04_012647|LXL04_012647|OH1004|cDNA

ATGCCACGAGAGTCAACAAACTTTCAACGGCTAGAATTGATATCGTTTTCCGGCGGGGAAACATTCAGACGGGAAATGGCGATTACTCTCTCAACAATCGCTCCGATCACTCGTACTCACCTCTCTGTTGCTAATAATTCGCCACCAAGTTGTACTTCAAGCAGTTATAGCTATAATCTCACTCTCTCCCCCTCCGTCACCGCCAACAAAACCGTCCTCGCTTCGTCATCACATACCCGCCACCCTGTCTCCGCCGCCGT...

CDS

Download CDS FASTA

861 bp · LXL04_012647|LXL04_012647|OH1004|CDS

ATGCCACGAGAGTCAACAAACTTTCAACGGCTAGAATTGATATCGTTTTCCGGCGGGGAAACATTCAGACGGGAAATGGCGATTACTCTCTCAACAATCGCTCCGATCACTCGTACTCACCTCTCTGTTGCTAATAATTCGCCACCAAGTTGTACTTCAAGCAGTTATAGCTATAATCTCACTCTCTCCCCCTCCGTCACCGCCAACAAAACCGTCCTCGCTTCGTCATCACATACCCGCCACCCTGTCTCCGCCGCCGT...

Protein

Download Protein FASTA

286 aa · LXL04_012647|LXL04_012647|OH1004|PROTEIN

MPRESTNFQRLELISFSGGETFRREMAITLSTIAPITRTHLSVANNSPPSCTSSSYSYNLTLSPSVTANKTVLASSSHTRHPVSAAVSSSTGTAESSSGISEETGSLLERVEVLDLNGNSIVISDLWKDRKAVVAFARHFGCVLCRKRADMLAAKKDTMDASGVALVLIGPGSADQARAFSEQTGFKGAEVYADPSYASYKALSFVSGVTTTFTPGAALKIIEAYMEGYRQDWELSFEKDTRTKGGWQQGGIMVAGPGIS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012647`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012647

Location Chr03:16229410-16230846 (+)

Description Similar to At2g37240: Thioredoxin-like protein AAED1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g37240`	Thioredoxin-like protein AAED1, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012647 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0045821 positive regulation of glycolytic process Biological Process

GO:0070374 positive regulation of ERK1 and ERK2 cascade Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016616 oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor Molecular Function

GO:0047017 prostaglandin F synthase activity Molecular Function

KEGG gene cross-reference

ath:AT2G37240

bta:616897

hsa:195827

mmu:66129

sasa:106582827

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.983

Rank 1 · LXL04_012647 · OH-1004

Mitochondrion0.026

Rank 2 · LXL04_012647 · OH-1004

Cytoplasm0.017

Rank 3 · LXL04_012647 · OH-1004

Nucleus0.016

Rank 4 · LXL04_012647 · OH-1004

Cell membrane0.013

Rank 5 · LXL04_012647 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00578.28AhpC-TSA111-199 aa

PF13911.13AhpC-TSA_2152-270 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012647	`PF00578.28`	AhpC-TSA	111	199	4.6e-06	27.3
LXL04_012647	`PF13911.13`	AhpC-TSA_2	152	270	6.6e-19	69.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZUU2`	Arabidopsis thaliana	Thioredoxin-like protein AAED1, chloroplastic	73.267%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card