TkA05G394680 | RubberDandelionOmics

Gene overview

TkA05G394680

Reference: TK1151 Chr: Chr05 Coordinates: 98102230-98106759 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1769 bp · TkA05G394680|TK1151|cDNA

TTTTGATACGTGATCCTGTTGTGGGTCCCGAAACAGGACTCAAAAGTCTTCTTGTTTTCCTGATCGTCTCTTTCTCACTCCTCACTCACTCTGTTACTAAACAAAATGAAGAACCGTCATCTCTTTCGATCAGCCATGGCCGTTACCTCCTCCAAGATTCGATCATCAGTAAGACATGTGCAGACTCTTTCCACCGTCAGATGGAAAAGTACCATTGCTGCCATGGCTGATGATGATGGATACAAGGGACATGGCATGTT...

CDS

Download CDS FASTA

1497 bp · TkA05G394680|TK1151|CDS

ATGAAGAACCGTCATCTCTTTCGATCAGCCATGGCCGTTACCTCCTCCAAGATTCGATCATCAGTAAGACATGTGCAGACTCTTTCCACCGTCAGATGGAAAAGTACCATTGCTGCCATGGCTGATGATGATGGATACAAGGGACATGGCATGTTAGCACCTTTCACAGCCGGCTGGCAAACTACTGAATCAAACCCATTGGTTATAGAGAAATCAGAGGGATCTTATGTGTATGATATAAATGGGAAGAAGTATCTTGA...

Protein

Download Protein FASTA

498 aa · TkA05G394680|TK1151|PROTEIN

MKNRHLFRSAMAVTSSKIRSSVRHVQTLSTVRWKSTIAAMADDDGYKGHGMLAPFTAGWQTTESNPLVIEKSEGSYVYDINGKKYLDALAGLWCNPLGGNEARLIAAANKQLNTLPFYHSFWNRTTKPSLDLASELLGMFTSNKMAKVFFTNSGSDANDTQVKLVWYYNNALGRPNKKKIIARTKSYHGSTLVSASLSGLPALHQNFDLPTPFVLHTDCPHYWRFHLPGETEEEFSTRLATNLEILILKEGPETIAAFIA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G394680`
TK1151 ID	TkA05G394680
OH-1004 ID	LXL04_021438
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 99.006 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G394680

Location Chr05:98102230-98106759 (-)

Description Similar to GABA-TP3: Gamma aminobutyrate transaminase 3, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g22200`	Transaminase that degrades gamma-amino butyric acid (GABA) and uses pyruvate or glyoxylate as amino-group acceptor, but not 2- oxoglutarate.	Pollen tube growth and guidance is regulated by POP2, an Arabidopsis gene that controls GABA levels.2003 · DOI: 10.1016/s0092-8674(03)00479-3 The Arabidopsis her1 mutant implicates GABA in E-2-hexenal responsiveness.2008 · DOI: 10.1111/j.1365-313x.2007.03323.x Biochemical characterization, mitochondrial localization, expression, and potential functions for an Arabidopsis gamma-aminobutyrate transaminase that utilizes both pyruvate and glyoxylate.2009 · DOI: 10.1093/jxb/erp044 Succinic semialdehyde dehydrogenase is involved in the robust patterning of Arabidopsis leaves along the adaxial-abaxial axis.2011 · DOI: 10.1093/pcp/pcr079

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0614600`	Transaminase that degrades gamma-amino butyric acid (GABA) and uses pyruvate as amino-group acceptor, but not 2-oxoglutarate.	No verified direct reference in this release
`UniProt: B8BBZ7`	Transaminase that degrades gamma-amino butyric acid (GABA).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021438 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009102 biotin biosynthetic process Biological Process

GO:0009448 gamma-aminobutyric acid metabolic process Biological Process

GO:0009821 alkaloid biosynthetic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004015 adenosylmethionine-8-amino-7-oxononanoate transaminase activity Molecular Function

GO:0030170 pyridoxal phosphate binding Molecular Function

GO:0034387 4-aminobutyrate:pyruvate transaminase activity Molecular Function

KEGG gene cross-reference

dosa:Os04g0614600

sly:543873

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.816

Rank 1 · TkA05G394680 · TK1151

Cytoplasm0.117

Rank 2 · TkA05G394680 · TK1151

Nucleus0.046

Rank 3 · TkA05G394680 · TK1151

Plastid0.038

Rank 4 · TkA05G394680 · TK1151

Peroxisome0.030

Rank 5 · TkA05G394680 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00202Aminotran_365-483 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G394680	`PF00202`	Aminotran_3	65	483	2.8e-89	300.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94CE5`	Arabidopsis thaliana	sp\|Q94CE5\|GATP_ARATH Gamma-aminobutyrate transaminase POP2, mitochondrial	80.700%	Swiss-Prot	High
`Q7XN11`	Oryza sativa subsp. japonica	sp\|Q7XN11\|GATP1_ORYSJ Gamma-aminobutyrate transaminase 1, mitochondrial	76.700%	Swiss-Prot	High
`B8BBZ7`	Oryza sativa subsp. indica	sp\|B8BBZ7\|GATP3_ORYSI Probable gamma-aminobutyrate transaminase 3, mitochondrial	79.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card