Gene Card
Gene overview
cDNA / CDS / Protein Sequences
3450 bp · TkA05G393190|TK1151|cDNA
ACACGAAACGAAATTAAGACGATTTCAAAATTCGAATTCGTGTTCGTGTCGTGTTCGTGTTGTAAAAAATTACACGATGTCGTGTCGTGTCGTGTTCGTGTTTAAATTTTGACACGTTAATAAAACGACAATAACACGATTTGAAAACGACAATAACACGATTTGAAAACGACAATAACACGATACATATATAGCCTAATTAATAATTTCTTTTATATATAAAAACAAATACATTAAATAAATACATTTCTTTTAATACT...
1401 bp · TkA05G393190|TK1151|CDS
ATGGGTTATATCAGTACAATTTTTATCGCTACGATTGTAACAGTTAGCATCGTTGGAGTTTACGTCAACGGAGAGGAAGGTGAATACGAAGATGCTGGAGTTGAAGCTCCCATGGTGAAAACAGAGCAAGAAGCTTTGTACTCTGCTATCCAAGGTTTTGTGGGTAAATGGTGGAATGGCTCAGATCTTTATCCCGATCCTTGTGGTTGGACTCCTATTCAGGGAGTTTCGTGTGACATTTACGATGGATTCTGGTATGT...
Protein
Download Protein FASTA466 aa · TkA05G393190|TK1151|PROTEIN
MGYISTIFIATIVTVSIVGVYVNGEEGEYEDAGVEAPMVKTEQEALYSAIQGFVGKWWNGSDLYPDPCGWTPIQGVSCDIYDGFWYVTGLNIGSIQDNSLACASNPEIRSSLFLLTHLKSLAFFDCFHPPPIVISSENWTLLSSSLESLEFRSNLGLTGAIPAAFSHLHKLQSLVVIGNGFSGGLPANIGNLTHLRRLVLSENGFSGEIGDDYGNLSELLILDLSRNSLSGSIPLTFGGLTSLLKLDLSQNQLVGKIPNE...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA05G393190 |
|---|---|
| TK1151 ID | TkA05G393190 |
| OH-1004 ID | LXL04_021412 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 99.600 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA05G393190 | ||||||
|---|---|---|---|---|---|---|---|
| Location | Chr05:97722213-97726179 (+) | ||||||
| Description | Similar to PII-2: Piriformospora indica-insensitive protein 2 | ||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | ||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||
| GO annotations (OH1004 source) | GO:0007165 signal transduction Biological Process GO:0008356 asymmetric cell division Biological Process GO:0009610 response to symbiotic fungus Biological Process GO:0009611 response to wounding Biological Process GO:0009620 response to fungus Biological Process GO:0009737 response to abscisic acid Biological Process GO:0010090 trichome morphogenesis Biological Process GO:0010375 stomatal complex patterning Biological Process GO:0010376 stomatal complex formation Biological Process GO:0042659 regulation of cell fate specification Biological Process GO:0044403 biological process involved in symbiotic interaction Biological Process GO:0045087 innate immune response Biological Process | ||||||
| KEGG gene cross-reference | ath:AT1G13230 ath:AT1G80080 ath:AT2G42800 ath:AT4G20140 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF12799LRR_4105-121 aaPF13855LRR_8112-121 aaPF24758LRR_At5g56370115-172 aaPF13516LRR_6116-126 aaPF23598LRR_14137-175 aaPF13855LRR_8144-179 aaPF13516LRR_6144-154 aaPF00560LRR_1145-168 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA05G393190 | PF12799 | LRR_4 | 105 | 121 | 3.3e-15 | 56.5 |
| TkA05G393190 | PF13855 | LRR_8 | 112 | 121 | 6.6e-20 | 71.3 |
| TkA05G393190 | PF24758 | LRR_At5g56370 | 115 | 172 | 0.012 | 16.0 |
| TkA05G393190 | PF13516 | LRR_6 | 116 | 126 | 0.0013 | 19.4 |
| TkA05G393190 | PF23598 | LRR_14 | 137 | 175 | 2.6e-15 | 56.8 |
| TkA05G393190 | PF13855 | LRR_8 | 144 | 179 | 6.6e-20 | 71.3 |
| TkA05G393190 | PF13516 | LRR_6 | 144 | 154 | 0.0013 | 19.4 |
| TkA05G393190 | PF00560 | LRR_1 | 145 | 168 | 1.2e-21 | 72.8 |
| TkA05G393190 | PF12799 | LRR_4 | 145 | 179 | 3.3e-15 | 56.5 |
| TkA05G393190 | PF24758 | LRR_At5g56370 | 147 | 203 | 0.012 | 16.0 |
| TkA05G393190 | PF25013 | LRR_Zer-1 | 167 | 202 | 2.9e-06 | 28.2 |
| TkA05G393190 | PF13516 | LRR_6 | 167 | 181 | 0.0013 | 19.4 |
| TkA05G393190 | PF24758 | LRR_At5g56370 | 168 | 230 | 0.012 | 16.0 |
| TkA05G393190 | PF00560 | LRR_1 | 170 | 192 | 1.2e-21 | 72.8 |
| TkA05G393190 | PF29252 | LRR_NLRC4 | 179 | 203 | 0.17 | 11.8 |
| TkA05G393190 | PF12799 | LRR_4 | 187 | 204 | 3.3e-15 | 56.5 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
| Protein | Organism | Description | Identity | Database | Confidence |
|---|---|---|---|---|---|
Q5PP26 | Arabidopsis thaliana | sp|Q5PP26|PII2_ARATH Piriformospora indica-insensitive protein 2 | 61.500% | Swiss-Prot | Low |