LXL04_021412 | RubberDandelionOmics

Gene overview

LXL04_021412

Reference: OH-1004 Chr: Chr04 Coordinates: 129117295-129118767 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1401 bp · LXL04_021412|LXL04_021412|OH1004|cDNA

ATGGGTTATATCAGTACAATTTTTATCGCTACGATTGTAACAGTTAGCATCGTTGGAGTTTACGTCAACGGAGAGGAAGGTGAATACGAAGATGCTGGAGTTGAAGCTCCCATGGTGAAAACAGAGCAAGAAGCTTTGTACTCTGCTATCCAAGGTTTTGTGGGTAAATGGTGGAATGGCTCAGATCTTTATCCCGATCCTTGTGGTTGGACTCCTATTCAGGGAGTTTCGTGTGACATTTACGATGGATTCTGGTATGT...

CDS

Download CDS FASTA

1401 bp · LXL04_021412|LXL04_021412|OH1004|CDS

ATGGGTTATATCAGTACAATTTTTATCGCTACGATTGTAACAGTTAGCATCGTTGGAGTTTACGTCAACGGAGAGGAAGGTGAATACGAAGATGCTGGAGTTGAAGCTCCCATGGTGAAAACAGAGCAAGAAGCTTTGTACTCTGCTATCCAAGGTTTTGTGGGTAAATGGTGGAATGGCTCAGATCTTTATCCCGATCCTTGTGGTTGGACTCCTATTCAGGGAGTTTCGTGTGACATTTACGATGGATTCTGGTATGT...

Protein

Download Protein FASTA

466 aa · LXL04_021412|LXL04_021412|OH1004|PROTEIN

MGYISTIFIATIVTVSIVGVYVNGEEGEYEDAGVEAPMVKTEQEALYSAIQGFVGKWWNGSDLYPDPCGWTPIQGVSCDIYDGFWYVTGLNIGSIQDNSLACASNPEIRSSLFLLTHLKSLAFFDCFHTPPIVISSENWTLLSGSLESLEFRSNLGLTGAIPAAFSHLHKLQSLVVIGNGFSGGLPANIGNLTHLRRLVLSENGFSGEIGDDYGNLSELLILDLSRNSLSGSIPLTFGGLTSLLKLDLSQNQLVGKIPNE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021412`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021412

Location Chr04:129117295-129118767 (+)

Description Similar to PII-2: Piriformospora indica-insensitive protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g13230`	Required for growth promotion and enhanced seed production mediated by the endophytic fungus Piriformospora indica.	A leucine-rich repeat protein is required for growth promotion and enhanced seed production mediated by the endophytic fungus Piriformospora indica in Arabidopsis thaliana.2007 · DOI: 10.1111/j.1365-313x.2007.03028.x
`At1g80080`	Promotes cell fate progression in stomatal development.	No verified direct reference in this release
`At2g42800`	Receptor like protein 29.	No verified direct reference in this release
`At4g20140`	Together with GSO2, receptor-like serine/threonine-kinase required during the development of the epidermal surface in embryos and cotyledons.	GASSHO1 and GASSHO2 encoding a putative leucine-rich repeat transmembrane-type receptor kinase are essential for the normal development of the epidermal surface in Arabidopsis embryos.2008 · DOI: 10.1111/j.1365-313x.2007.03395.x The receptor-like kinases GSO1 and GSO2 together regulate root growth in Arabidopsis through control of cell division and cell fate specification.2014 · DOI: 10.1002/dvdy.24066 A peptide hormone required for Casparian strip diffusion barrier formation in Arabidopsis roots.2017 · DOI: 10.1126/science.aai9057
`At1g08590`	Involved in the regulation of procambium maintenance and polarity during vascular-tissue development.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021412 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0008356 asymmetric cell division Biological Process

GO:0009610 response to symbiotic fungus Biological Process

GO:0009611 response to wounding Biological Process

GO:0009620 response to fungus Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0010090 trichome morphogenesis Biological Process

GO:0010375 stomatal complex patterning Biological Process

GO:0010376 stomatal complex formation Biological Process

GO:0042659 regulation of cell fate specification Biological Process

GO:0044403 biological process involved in symbiotic interaction Biological Process

GO:0045087 innate immune response Biological Process

KEGG gene cross-reference

ath:AT1G13230

ath:AT1G80080

ath:AT2G42800

ath:AT4G20140

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.741

Rank 1 · LXL04_021412 · OH-1004

Endoplasmic reticulum0.112

Rank 2 · LXL04_021412 · OH-1004

Lysosome / Vacuole0.066

Rank 3 · LXL04_021412 · OH-1004

Cytoplasm0.061

Rank 4 · LXL04_021412 · OH-1004

Nucleus0.045

Rank 5 · LXL04_021412 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23598.2LRR_14188-294 aa

PF13855.13LRR_8194-253 aa

PF13855.13LRR_8262-301 aa

PF13855.13LRR_8311-350 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021412	`PF23598.2`	LRR_14	188	294	3e-15	56.6
LXL04_021412	`PF13855.13`	LRR_8	194	253	1.1e-19	70.7
LXL04_021412	`PF13855.13`	LRR_8	262	301	1.1e-19	70.7
LXL04_021412	`PF13855.13`	LRR_8	311	350	1.1e-19	70.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q5PP26`	Arabidopsis thaliana	Piriformospora indica-insensitive protein 2	55.665%	Swiss-Prot	strong database homology
`Q9SSD1`	Arabidopsis thaliana	Protein TOO MANY MOUTHS	34.232%	Swiss-Prot	moderate database homology
`Q9SJH6`	Arabidopsis thaliana	Receptor like protein 29	33.509%	Swiss-Prot	moderate database homology
`C0LGQ5`	Arabidopsis thaliana	LRR receptor-like serine/threonine-protein kinase GSO1	34.819%	Swiss-Prot	moderate database homology
`Q9FRS6`	Arabidopsis thaliana	Leucine-rich repeat receptor-like protein kinase PXL1	36.752%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card