TkA05G383450 | RubberDandelionOmics

Gene overview

TkA05G383450

Reference: TK1151 Chr: Chr05 Coordinates: 95266807-95267294 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

396 bp · TkA05G383450|TK1151|cDNA

ATGATTAAGCATACCTCCGTTAACACGTTTTATGTCCAGGAATACATCATGGAAGCTTTATCCAGCAAGACGGTGTTACTTGTAACTCACCAAGTCGATTTCCTGCCTGCTTTTGACGATATATTGTTAATGGCAGACGGGAAGATTTTACAAACTGGAACCTACGATCAATTGCTTGATTCCTGTAAAGAGTTCCAAAACCTCGTGATTACACTTGGCGAAAGTTCTGGTTTGGATCAAACAGGCGATGACTCTCATCA...

CDS

Download CDS FASTA

396 bp · TkA05G383450|TK1151|CDS

ATGATTAAGCATACCTCCGTTAACACGTTTTATGTCCAGGAATACATCATGGAAGCTTTATCCAGCAAGACGGTGTTACTTGTAACTCACCAAGTCGATTTCCTGCCTGCTTTTGACGATATATTGTTAATGGCAGACGGGAAGATTTTACAAACTGGAACCTACGATCAATTGCTTGATTCCTGTAAAGAGTTCCAAAACCTCGTGATTACACTTGGCGAAAGTTCTGGTTTGGATCAAACAGGCGATGACTCTCATCA...

Protein

Download Protein FASTA

131 aa · TkA05G383450|TK1151|PROTEIN

MIKHTSVNTFYVQEYIMEALSSKTVLLVTHQVDFLPAFDDILLMADGKILQTGTYDQLLDSCKEFQNLVITLGESSGLDQTGDDSHQKSTSPNPEIEKINPIQEIAPSSVWEQLIKKEEREAGDTGLKPYK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G383450`
TK1151 ID	TkA05G383450
OH-1004 ID	LXL04_031961
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	95.400
Protein coverage (%)	TK1151 100.000 / OH-1004 78.916 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G383450

Location Chr05:95266807-95267294 (-)

Description Similar to ABCC10: ABC transporter C family member 10

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g59140`	Pump for glutathione S-conjugates.	No verified direct reference in this release
`At2g47800`	Involved in the regulation of stomatal aperture.	No verified direct reference in this release
`At3g13090`	Pump for glutathione S-conjugates.	No verified direct reference in this release
`At3g13100`	Pump for glutathione S-conjugates.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2XCD4`	ABC transporter that may affect phytic acid transport and compartmentalization.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031961 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009414 response to water deprivation Biological Process

GO:0009611 response to wounding Biological Process

GO:0009624 response to nematode Biological Process

GO:0010118 stomatal movement Biological Process

GO:0051707 response to other organism Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005774 vacuolar membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT2G47800

ath:AT3G13090

ath:AT3G13100

ath:AT3G59140

dosa:Os03g0142800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.556

Rank 1 · TkA05G383450 · TK1151

Nucleus0.341

Rank 2 · TkA05G383450 · TK1151

Cell membrane0.102

Rank 3 · TkA05G383450 · TK1151

Golgi apparatus0.099

Rank 4 · TkA05G383450 · TK1151

Endoplasmic reticulum0.075

Rank 5 · TkA05G383450 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22039HUTI_composite_bact43-59 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G383450	`PF22039`	HUTI_composite_bact	43	59	0.32	11.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LYS2`	Arabidopsis thaliana	sp\|Q9LYS2\|AB10C_ARATH ABC transporter C family member 10	48.100%	Swiss-Prot	Medium
`Q7DM58`	Arabidopsis thaliana	sp\|Q7DM58\|AB4C_ARATH ABC transporter C family member 4	38.900%	Swiss-Prot	Medium
`Q8VZZ4`	Arabidopsis thaliana	sp\|Q8VZZ4\|AB6C_ARATH ABC transporter C family member 6	40.000%	Swiss-Prot	Medium
`Q9LK62`	Arabidopsis thaliana	sp\|Q9LK62\|AB7C_ARATH ABC transporter C family member 7	36.900%	Swiss-Prot	Medium
`A2XCD4`	Oryza sativa subsp. indica	sp\|A2XCD4\|AB13C_ORYSI ABC transporter C family member 13	42.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card