LXL04_031961 | RubberDandelionOmics

Gene overview

LXL04_031961

Reference: OH-1004 Chr: Chr07 Coordinates: 13843602-13844194 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

501 bp · LXL04_031961|LXL04_031961|OH1004|cDNA

ATGATTAAGCATACCTCCGTTAACACATTTTATGTCCAGGAATACATCATGGAAGCTTTATCCAGCAAGACGGTGTTACTTGTAACTCACCAAGTCGATTTCATGCCTGCTTTTGACGATATCTTGTTAATGGCAGACGGGAAGATTTTACAAATTGGAACCTACGATCAATTGCTTGATTCCTGTAAAGAGTTCCAAAACCTCGTGATTACACTTGGCGAAAGTTCTGGTTCGGATCAAATAGGCGATGGCTCTCATCA...

CDS

Download CDS FASTA

501 bp · LXL04_031961|LXL04_031961|OH1004|CDS

ATGATTAAGCATACCTCCGTTAACACATTTTATGTCCAGGAATACATCATGGAAGCTTTATCCAGCAAGACGGTGTTACTTGTAACTCACCAAGTCGATTTCATGCCTGCTTTTGACGATATCTTGTTAATGGCAGACGGGAAGATTTTACAAATTGGAACCTACGATCAATTGCTTGATTCCTGTAAAGAGTTCCAAAACCTCGTGATTACACTTGGCGAAAGTTCTGGTTCGGATCAAATAGGCGATGGCTCTCATCA...

Protein

Download Protein FASTA

166 aa · LXL04_031961|LXL04_031961|OH1004|PROTEIN

MIKHTSVNTFYVQEYIMEALSSKTVLLVTHQVDFMPAFDDILLMADGKILQIGTYDQLLDSCKEFQNLVITLGESSGSDQIGDGSHQKSTSPNPEIEKINPIQEIAPSSVGEQLIKKEEREAGDTGLKPYKEYLTQSNGYFYFTLSVLSHLLYILGQFFTIDSISD

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031961`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_031961

Location Chr07:13843602-13844194 (+)

Description Similar to ABCC10: ABC transporter C family member 10

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g59140`	Pump for glutathione S-conjugates.	No verified direct reference in this release
`At2g47800`	Involved in the regulation of stomatal aperture.	No verified direct reference in this release
`At3g13090`	Pump for glutathione S-conjugates.	No verified direct reference in this release
`At3g13100`	Pump for glutathione S-conjugates.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0142800`	ABC transporter that may affect phytic acid transport and compartmentalization.	Mutations of the multi-drug resistance-associated protein ABC transporter gene 5 result in reduction of phytic acid in rice seeds.2009 · DOI: 10.1007/s00122-009-1018-1

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031961 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009414 response to water deprivation Biological Process

GO:0009611 response to wounding Biological Process

GO:0009624 response to nematode Biological Process

GO:0010118 stomatal movement Biological Process

GO:0051707 response to other organism Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005774 vacuolar membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT2G47800

ath:AT3G13090

ath:AT3G13100

ath:AT3G59140

dosa:Os03g0142800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.343

Rank 1 · LXL04_031961 · OH-1004

Cytoplasm0.252

Rank 2 · LXL04_031961 · OH-1004

Lysosome / Vacuole0.235

Rank 3 · LXL04_031961 · OH-1004

Golgi apparatus0.209

Rank 4 · LXL04_031961 · OH-1004

Cell membrane0.186

Rank 5 · LXL04_031961 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LYS2`	Arabidopsis thaliana	ABC transporter C family member 10	44.304%	Swiss-Prot	moderate database homology
`Q7DM58`	Arabidopsis thaliana	ABC transporter C family member 4	35.088%	Swiss-Prot	moderate database homology
`Q8VZZ4`	Arabidopsis thaliana	ABC transporter C family member 6	35.329%	Swiss-Prot	moderate database homology
`Q9LK62`	Arabidopsis thaliana	ABC transporter C family member 7	35.252%	Swiss-Prot	moderate database homology
`Q10RX7`	Oryza sativa subsp. japonica	ABC transporter C family member 13	30.682%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card