Gene Card
Gene overview
cDNA / CDS / Protein Sequences
381 bp · TkA05G368410|TK1151|cDNA
ATGGATTGTCACTGTGTATGTGTGTTCCTCTATATGTATTTCTCAGTGACAACCAAATTATTGAGCATAGAAAACTTAAATTTGATCGGTGAGTGTTTTTCTGTGACAAAGGTTTATGGAGTCACTGAAAAGAGACTGAAACTTATTAATGGCAGATCGAGGCAACTACATCTAACATTCAAAAGACCAATTCATACCCATGGAAAACAGATCAAGACCAATTCATACCCATGTATTTCTCACAAAAGCATTTCCACAAC...
381 bp · TkA05G368410|TK1151|CDS
ATGGATTGTCACTGTGTATGTGTGTTCCTCTATATGTATTTCTCAGTGACAACCAAATTATTGAGCATAGAAAACTTAAATTTGATCGGTGAGTGTTTTTCTGTGACAAAGGTTTATGGAGTCACTGAAAAGAGACTGAAACTTATTAATGGCAGATCGAGGCAACTACATCTAACATTCAAAAGACCAATTCATACCCATGGAAAACAGATCAAGACCAATTCATACCCATGTATTTCTCACAAAAGCATTTCCACAAC...
Protein
Download Protein FASTA126 aa · TkA05G368410|TK1151|PROTEIN
MDCHCVCVFLYMYFSVTTKLLSIENLNLIGECFSVTKVYGVTEKRLKLINGRSRQLHLTFKRPIHTHGKQIKTNSYPCISHKSISTTRIPSADSFLAAHVEDESSSDVENQDVSSLVKDDSNGTKA
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA05G368410 |
|---|---|
| TK1151 ID | TkA05G368410 |
| OH-1004 ID | LXL04_028849 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 86.700 |
| Protein coverage (%) | TK1151 23.810 / OH-1004 8.499Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA05G368410 |
|---|---|
| Location | Chr05:91467005-91467457 (+) |
| Description | Similar to HSF30: Heat shock factor protein HSF30 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0001666 response to hypoxia Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006357 regulation of transcription by RNA polymerase II Biological Process GO:0009408 response to heat Biological Process GO:0010286 heat acclimation Biological Process GO:0034605 cellular response to heat Biological Process GO:0034620 cellular response to unfolded protein Biological Process GO:0042542 response to hydrogen peroxide Biological Process GO:0045893 positive regulation of DNA-templated transcription Biological Process GO:0071456 cellular response to hypoxia Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component |
| KEGG gene cross-reference | ath:AT2G26150 dosa:Os03g0161900 dosa:Os03g0795900 dosa:Os07g0178600 osa:4331707 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
No result was found for this query.
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.