LXL04_028849 | RubberDandelionOmics

Gene overview

LXL04_028849

Reference: OH-1004 Chr: Chr06 Coordinates: 70778300-70779890 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1108 bp · LXL04_028849|LXL04_028849|OH1004|cDNA

TGAATAACGACATTCACCATCGGTAATCGAAGAAATATCATCGACAATGGATTTGAAAATGGAACTGCAAGGAGGAGTTAATGTGAAAGAAGAGGAGGTTACATTTATATCGTCAACGAACACTACCGCAACCGCTGGTTCATCCTCTTCGTCTTCTTCCCCACGGCCGAGGGAAGGGTTGCATGAGGTAGGTCCACCGCCGTTCCTGACAAAAACATTCGATATGGTGGAAGATCCGTCGACGGATTCGGTGGTTTCGT...

CDS

Download CDS FASTA

1062 bp · LXL04_028849|LXL04_028849|OH1004|CDS

ATGGATTTGAAAATGGAACTGCAAGGAGGAGTTAATGTGAAAGAAGAGGAGGTTACATTTATATCGTCAACGAACACTACCGCAACCGCTGGTTCATCCTCTTCGTCTTCTTCCCCACGGCCGAGGGAAGGGTTGCATGAGGTAGGTCCACCGCCGTTCCTGACAAAAACATTCGATATGGTGGAAGATCCGTCGACGGATTCGGTGGTTTCGTGGAGTGGAGGAAGAAATAGTTTTGTTGTTTGGGATTCTCATAAGTT...

Protein

Download Protein FASTA

353 aa · LXL04_028849|LXL04_028849|OH1004|PROTEIN

MDLKMELQGGVNVKEEEVTFISSTNTTATAGSSSSSSSPRPREGLHEVGPPPFLTKTFDMVEDPSTDSVVSWSGGRNSFVVWDSHKFSTTLLPKYFKHGNFSSFIRQLNTYGFRKVDPDRWEFANEGFLGGQRHLLKTIRRRRNIAQSTHQKQEFGPCIEVGQYGIEEELQGLKRDRNLLMAEIVRLRQLQQHSKDQLVAMENRLRTTERKQQNMMGFLAKAFSNPEFLHKYMEKYAHREQEHIEIGRKRRLTMTPSIEN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_028849`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_028849

Location Chr06:70778300-70779890 (-)

Description Similar to HSF30: Heat shock factor protein HSF30

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g26150`	Transcriptional activator that specifically binds DNA sequence 5'-AGAAnnTTCT-3' known as heat shock promoter elements (HSE).	The heat stress transcription factor HsfA2 serves as a regulatory amplifier of a subset of genes in the heat stress response in Arabidopsis.2006 · DOI: 10.1007/s11103-005-5750-x Arabidopsis heat shock transcription factor A2 as a key regulator in response to several types of environmental stress.2006 · DOI: 10.1111/j.1365-313x.2006.02889.x A heat-inducible transcription factor, HsfA2, is required for extension of acquired thermotolerance in Arabidopsis.2007 · DOI: 10.1104/pp.106.091322 An H3K27me3 demethylase-HSFA2 regulatory loop orchestrates transgenerational thermomemory in Arabidopsis.2019 · DOI: 10.1038/s41422-019-0145-8

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0178600`	Transcriptional regulator that specifically binds DNA of heat shock promoter elements (HSE).	No verified direct reference in this release
`Os03g0161900`	Transcriptional regulator that specifically binds DNA of heat shock promoter elements (HSE).	No verified direct reference in this release
`Os03g0795900`	Transcriptional activator expressed upon environmental stress that specifically binds DNA of heat shock promoter elements (HSE).	Expression of rice heat stress transcription factor OsHsfA2e enhances tolerance to environmental stresses in transgenic Arabidopsis.2008 · DOI: 10.1007/s00425-007-0670-4

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028849 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0001666 response to hypoxia Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0009408 response to heat Biological Process

GO:0010286 heat acclimation Biological Process

GO:0034605 cellular response to heat Biological Process

GO:0034620 cellular response to unfolded protein Biological Process

GO:0042542 response to hydrogen peroxide Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT2G26150

dosa:Os03g0161900

dosa:Os03g0795900

dosa:Os07g0178600

osa:4331707

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.955

Rank 1 · LXL04_028849 · OH-1004

Cytoplasm0.138

Rank 2 · LXL04_028849 · OH-1004

Cell membrane0.021

Rank 3 · LXL04_028849 · OH-1004

Mitochondrion0.013

Rank 4 · LXL04_028849 · OH-1004

Endoplasmic reticulum0.011

Rank 5 · LXL04_028849 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00447.24HSF_DNA-bind53-142 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_028849	`PF00447.24`	HSF_DNA-bind	53	142	5.4e-28	98.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80982`	Arabidopsis thaliana	Heat stress transcription factor A-2	53.918%	Swiss-Prot	strong database homology
`Q6VBB2`	Oryza sativa subsp. japonica	Heat stress transcription factor A-2b	47.904%	Swiss-Prot	moderate database homology
`Q8H7Y6`	Oryza sativa subsp. japonica	Heat stress transcription factor A-2d	60.784%	Swiss-Prot	moderate database homology
`Q6F388`	Oryza sativa subsp. japonica	Heat stress transcription factor A-2e	46.951%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card