TkA05G316510 | RubberDandelionOmics

Gene overview

TkA05G316510

Reference: TK1151 Chr: Chr05 Coordinates: 78118440-78126277 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2567 bp · TkA05G316510|TK1151|cDNA

CTTGTATCTCTGGATGTTAATGAGATTTACACATTTCCAATTATCTTTTCCTTCTCTCAAAGTTAATATCTTTCTCTCAAAGTTAATATTATACCTTCAAAGTCAATCTTCGTCACATAATCATCTTCTTCCATTTTTTCGTCGATCGATTATTCTCCTCCCACTTTCTCCTCTTTTTTGACCCAGTCTAAACGAACAGACCAGGATAGGCAAGGGGTGATCACCTACCATTTACCGTTATATAATAATCCGGAACAACA...

CDS

Download CDS FASTA

1953 bp · TkA05G316510|TK1151|CDS

ATGAAGAAACCAACACACACAGCTTCGATTCTAATTACTCTAATCGCAATTCTGTCACTAGTAATTCCATCAGAAGGAGATGCTAGATCTCAAATCATCAACATCACATGCGACAATCAACTAGAAAACAACCAAACCCTATTCATCCCCAACTTCGTCCGCACAATGGAAACAATCGGCACGATAATGCGAACCTCCCGTAACGGCACCGCCCTCACCGGCACCGGACCCGACAGCAACTACGGCCTCGCACAATGCTA...

Protein

Download Protein FASTA

650 aa · TkA05G316510|TK1151|PROTEIN

MKKPTHTASILITLIAILSLVIPSEGDARSQIINITCDNQLENNQTLFIPNFVRTMETIGTIMRTSRNGTALTGTGPDSNYGLAQCYGDLSTQDCILCYAEARTVLPSCYPNNGGRIYLDGCFMRVQNYSFYHEYADPNDRVVCGNTTSKSRSFQGLVTQAVGNAVADASRNWDYFARESLSNGNESVFVMADCWRTLSRADCRACLENASAALSTCSPWTEGRALNTGCFMRFSDRDFLNPIQVAASSSNRGKVIAISV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G316510`
TK1151 ID	TkA05G316510
OH-1004 ID	LXL04_020848
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 97.892 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G316510

Location Chr05:78118440-78126277 (+)

Description Similar to CRK2: Cysteine-rich receptor-like protein kinase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g70520`	Cysteine-rich receptor-like protein kinase 2.	No verified direct reference in this release
`At5g40380`	Cysteine-rich receptor-like protein kinase 42.	No verified direct reference in this release
`At1g70530`	Cysteine-rich receptor-like protein kinase 3.	No verified direct reference in this release
`At4g28670`	Cysteine-rich receptor-like protein kinase 46.	No verified direct reference in this release
`At1g19090`	Cysteine-rich receptor-like protein kinase 1.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020848 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0010193 response to ozone Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0052545 callose localization Biological Process

GO:0072593 reactive oxygen species metabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G19090

ath:AT1G70520

ath:AT1G70530

ath:AT4G28670

ath:AT5G40380

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.893

Rank 1 · TkA05G316510 · TK1151

Cytoplasm0.073

Rank 2 · TkA05G316510 · TK1151

Endoplasmic reticulum0.067

Rank 3 · TkA05G316510 · TK1151

Nucleus0.042

Rank 4 · TkA05G316510 · TK1151

Lysosome / Vacuole0.022

Rank 5 · TkA05G316510 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01657Stress-antifung37-129 aa

PF01657Stress-antifung144-236 aa

PF17667Pkinase_fungal188-211 aa

PF00069Pkinase323-594 aa

PF07714PK_Tyr_Ser-Thr325-595 aa

PF03109ABC1328-350 aa

PF03109ABC1427-475 aa

PF17667Pkinase_fungal438-508 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G316510	`PF01657`	Stress-antifung	37	129	2e-23	83.6
TkA05G316510	`PF01657`	Stress-antifung	144	236	2e-23	83.6
TkA05G316510	`PF17667`	Pkinase_fungal	188	211	0.00013	21.6
TkA05G316510	`PF00069`	Pkinase	323	594	7.5e-45	154.1
TkA05G316510	`PF07714`	PK_Tyr_Ser-Thr	325	595	6.9e-46	157.4
TkA05G316510	`PF03109`	ABC1	328	350	1.5e-05	25.0
TkA05G316510	`PF03109`	ABC1	427	475	1.5e-05	25.0
TkA05G316510	`PF17667`	Pkinase_fungal	438	508	0.00013	21.6
TkA05G316510	`PF03109`	ABC1	510	554	1.5e-05	25.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9CAL3`	Arabidopsis thaliana	sp\|Q9CAL3\|CRK2_ARATH Cysteine-rich receptor-like protein kinase 2	62.300%	Swiss-Prot	High
`Q9FNE1`	Arabidopsis thaliana	sp\|Q9FNE1\|CRK42_ARATH Cysteine-rich receptor-like protein kinase 42	42.200%	Swiss-Prot	Medium
`Q9CAL2`	Arabidopsis thaliana	sp\|Q9CAL2\|CRK3_ARATH Cysteine-rich receptor-like protein kinase 3	41.800%	Swiss-Prot	Medium
`Q9M0G5`	Arabidopsis thaliana	sp\|Q9M0G5\|CRK46_ARATH Cysteine-rich receptor-like protein kinase 46	40.300%	Swiss-Prot	Medium
`Q9LMB9`	Arabidopsis thaliana	sp\|Q9LMB9\|CRK1_ARATH Cysteine-rich receptor-like protein kinase 1	42.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card