LXL04_020848 | RubberDandelionOmics

Gene overview

LXL04_020848

Reference: OH-1004 Chr: Chr04 Coordinates: 111120136-111123619 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1995 bp · LXL04_020848|LXL04_020848|OH1004|cDNA

ATGACCGTCATTCTTCCGATATTCCCTCTCCAGTCAACGAAGATGAAGAAACCAACACACACAGCTTCGATTCTAATTACTCTAATCGCAATTCTGTCACTAGTAATTCCATCAGAAGGAGATGCTAGATCTCAAATCATCAACATCACATGCGACAATCAACTAGAAAACAACCAAACCCTATTCATCCCCAACTTCGTCCGCACAATGGAAACAATCGGCACGATAATGCGAACCTCCCGTAACGGCACCGCCCTCAC...

CDS

Download CDS FASTA

1995 bp · LXL04_020848|LXL04_020848|OH1004|CDS

ATGACCGTCATTCTTCCGATATTCCCTCTCCAGTCAACGAAGATGAAGAAACCAACACACACAGCTTCGATTCTAATTACTCTAATCGCAATTCTGTCACTAGTAATTCCATCAGAAGGAGATGCTAGATCTCAAATCATCAACATCACATGCGACAATCAACTAGAAAACAACCAAACCCTATTCATCCCCAACTTCGTCCGCACAATGGAAACAATCGGCACGATAATGCGAACCTCCCGTAACGGCACCGCCCTCAC...

Protein

Download Protein FASTA

664 aa · LXL04_020848|LXL04_020848|OH1004|PROTEIN

MTVILPIFPLQSTKMKKPTHTASILITLIAILSLVIPSEGDARSQIINITCDNQLENNQTLFIPNFVRTMETIGTIMRTSRNGTALTGTGPDSNYGLAQCYGDLSTQDCILCYAEARTVLPSCYPNNGGRIYLDGCFMRVQNYSFYHEYADPNDRVVCGNTTSKSRSFQGLVTQAVGNAVADASRNWDYFARESLSNGNESVFVMADCWRTLSRADCRACLENASAALSTCSPWTEGRALNTGCFMRFSDRDFLNPIPVA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_020848`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_020848

Location Chr04:111120136-111123619 (+)

Description Similar to CRK2: Cysteine-rich receptor-like protein kinase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g70520`	Cysteine-rich receptor-like protein kinase 2.	No verified direct reference in this release
`At5g40380`	Cysteine-rich receptor-like protein kinase 42.	No verified direct reference in this release
`At1g70530`	Cysteine-rich receptor-like protein kinase 3.	No verified direct reference in this release
`At4g28670`	Cysteine-rich receptor-like protein kinase 46.	No verified direct reference in this release
`At1g19090`	Cysteine-rich receptor-like protein kinase 1.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020848 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0010193 response to ozone Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0052545 callose localization Biological Process

GO:0072593 reactive oxygen species metabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G19090

ath:AT1G70520

ath:AT1G70530

ath:AT4G28670

ath:AT5G40380

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.890

Rank 1 · LXL04_020848 · OH-1004

Cytoplasm0.073

Rank 2 · LXL04_020848 · OH-1004

Endoplasmic reticulum0.069

Rank 3 · LXL04_020848 · OH-1004

Nucleus0.043

Rank 4 · LXL04_020848 · OH-1004

Lysosome / Vacuole0.022

Rank 5 · LXL04_020848 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01657.23Stress-antifung51-143 aa

PF01657.23Stress-antifung158-250 aa

PF00069.32Pkinase337-608 aa

PF07714.24PK_Tyr_Ser-Thr339-609 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_020848	`PF01657.23`	Stress-antifung	51	143	6.9e-23	81.9
LXL04_020848	`PF01657.23`	Stress-antifung	158	250	6.9e-23	81.9
LXL04_020848	`PF00069.32`	Pkinase	337	608	6.9e-45	154.2
LXL04_020848	`PF07714.24`	PK_Tyr_Ser-Thr	339	609	7.5e-46	157.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9CAL3`	Arabidopsis thaliana	Cysteine-rich receptor-like protein kinase 2	62.614%	Swiss-Prot	strong database homology
`Q9FNE1`	Arabidopsis thaliana	Cysteine-rich receptor-like protein kinase 42	42.951%	Swiss-Prot	moderate database homology
`Q9CAL2`	Arabidopsis thaliana	Cysteine-rich receptor-like protein kinase 3	41.818%	Swiss-Prot	moderate database homology
`Q9M0G5`	Arabidopsis thaliana	Cysteine-rich receptor-like protein kinase 46	40.190%	Swiss-Prot	moderate database homology
`Q9LMB9`	Arabidopsis thaliana	Cysteine-rich receptor-like protein kinase 1	40.433%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card