TkA05G314700 | RubberDandelionOmics

Gene overview

TkA05G314700

Reference: TK1151 Chr: Chr05 Coordinates: 77659205-77665203 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2827 bp · TkA05G314700|TK1151|cDNA

CCGACTCCTTGTAAAAATCCAAAAATACAAACCCTAAAGGCTCATAGCCTCATACCTTTCTTGATGCAGCGGTACTGAAATAAATATTTATTTTACTAAAGAAAAAGCGTTTCGATCATCTGGAAGAGGAACTCGCACTCACCTACCATCTGAAAGACCAGCTGCTGTCCCTTGACTGCTTCATCTTAATATTAATCTTAATTGATACATCTACTGCTATCGGAATCCTCTGCAAACTCTTCACCGAAATGGACCTGAAG...

CDS

Download CDS FASTA

2172 bp · TkA05G314700|TK1151|CDS

ATGCCTCGCAAAGTATCATATGGAGTTGATTTTGATGAAGAGTATGATGCTTATGATGATTACCGTGATGATTATGATTATAATTATAACCATGGCAATGGTGTAGATGAACATGAACATGAAAATGTTACATCAGCTTGGGAATCTCCTGATGTTACAATTACAAAACAAGAAATTGTGCAGCAAAATGTATGGCGATGTCCCATATGTACATATGATAATGAGGAATATATGTCTGCATGTGACATATGTGGTGTTCT...

Protein

Download Protein FASTA

723 aa · TkA05G314700|TK1151|PROTEIN

MPRKVSYGVDFDEEYDAYDDYRDDYDYNYNHGNGVDEHEHENVTSAWESPDVTITKQEIVQQNVWRCPICTYDNEEYMSACDICGVLRNPLIKSSNNGQSSTVDGVSMMAKSLFTSLPHGGGVNVNFQTEPQKDASSRKEDFQGNIRGQFHDLHNAIISEKHYKVNIAPFKFDTPSPDDVVSLGLQSYKLGSKVVSNLEKPSTSTTKKTENTTNLKSNAKSSNKSTPPLTSKDKFEENNVTETHRISSEINTMTMNPKSE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G314700`
TK1151 ID	TkA05G314700
OH-1004 ID	LXL04_020827
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.800
Protein coverage (%)	TK1151 100.000 / OH-1004 94.889 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G314700`
Location	Chr05:77659205-77665203 (+)
Description	Similar to HBS1L: HBS1-like protein
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_020827` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006412 translation Biological Process GO:0006417 regulation of translation Biological Process GO:0007165 signal transduction Biological Process GO:0032790 ribosome disassembly Biological Process GO:0070966 nuclear-transcribed mRNA catabolic process, no-go decay Biological Process GO:0072344 rescue of stalled cytosolic ribosome Biological Process GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0016020 membrane Cellular Component GO:0022626 cytosolic ribosome Cellular Component GO:0070062 extracellular exosome Cellular Component GO:1990533 Dom34-Hbs1 complex Cellular Component
KEGG gene cross-reference	bta:541083 hsa:10767 mmu:56422 pon:100173449 rno:293408 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.446

Rank 1 · TkA05G314700 · TK1151

Nucleus0.251

Rank 2 · TkA05G314700 · TK1151

Golgi apparatus0.131

Rank 3 · TkA05G314700 · TK1151

Cell membrane0.115

Rank 4 · TkA05G314700 · TK1151

Endoplasmic reticulum0.106

Rank 5 · TkA05G314700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04810zf-Sec23_Sec2461-75 aa

PF16988Vps36-NZF-N61-77 aa

PF00641Zn_ribbon_RanBP65-85 aa

PF04810zf-Sec23_Sec2481-99 aa

PF22594GTP-eEF1A_C245-288 aa

PF00009GTP_EFTU294-503 aa

PF01926MMR_HSR1296-318 aa

PF22594GTP-eEF1A_C308-341 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G314700	`PF04810`	zf-Sec23_Sec24	61	75	0.24	12.1
TkA05G314700	`PF16988`	Vps36-NZF-N	61	77	0.27	11.4
TkA05G314700	`PF00641`	Zn_ribbon_RanBP	65	85	0.0035	17.3
TkA05G314700	`PF04810`	zf-Sec23_Sec24	81	99	0.24	12.1
TkA05G314700	`PF22594`	GTP-eEF1A_C	245	288	3.2e-27	95.6
TkA05G314700	`PF00009`	GTP_EFTU	294	503	9e-48	163.1
TkA05G314700	`PF01926`	MMR_HSR1	296	318	0.00022	22.0
TkA05G314700	`PF22594`	GTP-eEF1A_C	308	341	3.2e-27	95.6
TkA05G314700	`PF03144`	GTP_EFTU_D2	319	344	5.2e-09	37.1
TkA05G314700	`PF01926`	MMR_HSR1	336	410	0.00022	22.0
TkA05G314700	`PF03144`	GTP_EFTU_D2	541	604	5.2e-09	37.1
TkA05G314700	`PF14578`	GTP_EFTU_D4	541	591	0.00037	21.1
TkA05G314700	`PF03143`	GTP_EFTU_D3	578	592	4e-10	40.7
TkA05G314700	`PF22594`	GTP-eEF1A_C	616	715	3.2e-27	95.6
TkA05G314700	`PF03143`	GTP_EFTU_D3	616	717	4e-10	40.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card