TkA05G300050 | RubberDandelionOmics

Gene overview

TkA05G300050

Reference: TK1151 Chr: Chr05 Coordinates: 74020743-74022519 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1374 bp · TkA05G300050|TK1151|cDNA

GTCACGAACAAATTGCGCGTGAGCTCCGTGGCCGCATAATCATCCTCTAAGTACCGCTTCCGGCCACCAAATAAAGAAGGTTTTAGACGCATAGAAACCGTCATCAAGTATGACCGAACGGACTTGGCCTCACCGATCAGAAACCTCTCACTTCTCAACCCTACCCTTCCCTATTAAAAATTCGACTCGAAAACATGAAAATTCTACTTCAAAGTCAATTCGTGTTCGGCAGTTCCGACCATCGCCATCATCTCGACGGT...

CDS

Download CDS FASTA

1020 bp · TkA05G300050|TK1151|CDS

ATGACCGAACGGACTTGGCCTCACCGATCAGAAACCTCTCACTTCTCAACCCTACCCTTCCCTATTAAAAATTCGACTCGAAAACATGAAAATTCTACTTCAAAGTCAATTCGTGTTCGGCAGTTCCGACCATCGCCATCATCTCGACGGTCCGACCAATTCCGTGACTTCGCCGCGCTACCTAACGACGTGTTGACAAAAATTGCGGCGAATTTTAGCCTCCCGAATTTACAGGCAGCGTCGTTGGTTTGCAAATCATG...

Protein

Download Protein FASTA

339 aa · TkA05G300050|TK1151|PROTEIN

MTERTWPHRSETSHFSTLPFPIKNSTRKHENSTSKSIRVRQFRPSPSSRRSDQFRDFAALPNDVLTKIAANFSLPNLQAASLVCKSWRDGLLPLREAMLFLRWGKRFKHGRGGVQPNVEKALDSFLKGAARGSTLAMVDAGLIYWEMGKKEEGVALYRKAAELGDTAGQCNLGISYLQADPPNVKEAVKWLYQASIAGYVRGQYQLALCLHRGSGMNQNLPEAAKWYLRAAEGGYVRAMYNVSLCYSLGTGFSQNHRQSR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G300050`
TK1151 ID	TkA05G300050
OH-1004 ID	LXL04_020739
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	77.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G300050

Location Chr05:74020743-74022519 (+)

Description Similar to At1g70590: F-box protein At1g70590

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g70590`	F-box protein At1g70590.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020739 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006641 triglyceride metabolic process Biological Process

GO:0007219 Notch signaling pathway Biological Process

GO:0009306 protein secretion Biological Process

GO:0030970 retrograde protein transport, ER to cytosol Biological Process

GO:0034976 response to endoplasmic reticulum stress Biological Process

GO:0036503 ERAD pathway Biological Process

GO:0050821 protein stabilization Biological Process

GO:0000836 Hrd1p ubiquitin ligase complex Cellular Component

GO:0000839 Hrd1p ubiquitin ligase ERAD-L complex Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

KEGG gene cross-reference

ath:AT1G70590

hsa:6400

maua:101834260

mmu:20338

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.422

Rank 1 · TkA05G300050 · TK1151

Nucleus0.368

Rank 2 · TkA05G300050 · TK1151

Mitochondrion0.184

Rank 3 · TkA05G300050 · TK1151

Plastid0.075

Rank 4 · TkA05G300050 · TK1151

Peroxisome0.042

Rank 5 · TkA05G300050 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15966F-box_44-42 aa

PF15966F-box_456-109 aa

PF12937F-box-like58-89 aa

PF00646F-box60-89 aa

PF18511F-box_579-87 aa

PF08238Sel1103-132 aa

PF07719TPR_2117-127 aa

PF00515TPR_1119-127 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G300050	`PF15966`	F-box_4	4	42	0.018	15.7
TkA05G300050	`PF15966`	F-box_4	56	109	0.018	15.7
TkA05G300050	`PF12937`	F-box-like	58	89	7.4e-06	26.3
TkA05G300050	`PF00646`	F-box	60	89	7.9e-07	29.5
TkA05G300050	`PF18511`	F-box_5	79	87	0.19	12.0
TkA05G300050	`PF08238`	Sel1	103	132	1.5e-26	92.5
TkA05G300050	`PF07719`	TPR_2	117	127	0.05	14.5
TkA05G300050	`PF00515`	TPR_1	119	127	0.0096	16.4
TkA05G300050	`PF13432`	TPR_16	129	164	0.016	16.3
TkA05G300050	`PF13424`	TPR_12	135	162	4.9	8.1
TkA05G300050	`PF13174`	TPR_6	136	161	0.059	14.7
TkA05G300050	`PF13181`	TPR_8	138	163	0.0029	18.4
TkA05G300050	`PF13374`	TPR_10	138	162	0.37	11.6
TkA05G300050	`PF13432`	TPR_16	139	194	0.016	16.3
TkA05G300050	`PF07719`	TPR_2	139	163	0.05	14.5
TkA05G300050	`PF13424`	TPR_12	139	163	4.9	8.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94C27`	Arabidopsis thaliana	sp\|Q94C27\|FB84_ARATH F-box protein At1g70590	65.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card