RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA05G099000
Reference: TK1151 Chr: Chr05 Coordinates: 26674626-26680437 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

3019 bp · TkA05G099000|TK1151|cDNA

CTTTACTTTACTTGAAGTAAACTTGTTCATTAGCAGATATGTATGACTTCCACACACACACACACACACACATACACTGAGCATCCATTCATTTTCTTTCCAGAGAGAGAAAGTAGAGAGAGAATTAATCTTTTCCTGTCTGTCATCTCTGCAACTTTCCACCATTTCTCTCACCTTTTCCTCTGTTCATCGCCTCTTCAAGGTGATCGAGGTTGAACTGGATATGCAGCGGTCAATTTATCGGAAGAAATAGCTGTTTT...

CDS

Download CDS FASTA

2406 bp · TkA05G099000|TK1151|CDS

ATGGGTGTCGAGAGATCTGTAATTTACTTGTTGCTATTCTTAGGGTTTGTATTGATCTTCGTGGGCCCAATTTCTCTTGCTACCAATCCTGCAGATGTTAGTGCAATAAATAAACTATATGTTGCATTGGGATCTCCTCCACTTCCCGGATGGACGGCTAGTGCTGGAGACCCGTGTATCGAGAATTGGCAAGGTGTTACATGTGACCTTACTAAAACAAACATCTTATCAATAGTTGTTCATGGTGCCAATTTAGTAGG...

Protein

Download Protein FASTA

801 aa · TkA05G099000|TK1151|PROTEIN

MGVERSVIYLLLFLGFVLIFVGPISLATNPADVSAINKLYVALGSPPLPGWTASAGDPCIENWQGVTCDLTKTNILSIVVHGANLVGELGDTLGSFTSLQSIDLSNNLIGGSIPTAFPVTVTTIFLADNNFTGTIPIFLTSMTQLTALSLNDNKLSGEIPDFFEGLTGLVNLDLSSNDLSGELPSSLQSLSSLTTFNLQNNQLSGTLDVLQDLPLTNLNVENNLFNGPIPAKLLAIPNFRNEGNLFNSTSTAPLSPPSSP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA05G099000
TK1151 IDTkA05G099000
OH-1004 IDLXL04_019876
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)99.000
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA05G099000
LocationChr05:26674626-26680437 (-)
DescriptionSimilar to SRF3: Protein STRUBBELIG-RECEPTOR FAMILY 3
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g03390 Not essential for epidermal patterning and not redundant with STRUBBELIG.
The role of the SCRAMBLED receptor-like kinase in patterning the Arabidopsis root epidermis.2007 · DOI: 10.1016/j.ydbio.2006.09.009
At2g20850 Not essential for epidermal patterning and not redundant with STRUBBELIG.
The role of the SCRAMBLED receptor-like kinase in patterning the Arabidopsis root epidermis.2007 · DOI: 10.1016/j.ydbio.2006.09.009
Molecular characterisation of the STRUBBELIG-RECEPTOR FAMILY of genes encoding putative leucine-rich repeat receptor-like kinases in Arabidopsis thaliana.2007 · DOI: 10.1186/1471-2229-7-16
At1g11130 Regulates the expression of transcription factors that define the cell fates. No verified direct reference in this release
At1g53730 Protein STRUBBELIG-RECEPTOR FAMILY 6. No verified direct reference in this release
At4g22130 Protein STRUBBELIG-RECEPTOR FAMILY 8. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_019876 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0007165 signal transduction Biological Process
GO:0007623 circadian rhythm Biological Process
GO:0052543 callose deposition in cell wall Biological Process
GO:0060586 multicellular organismal-level iron ion homeostasis Biological Process
GO:0005576 extracellular region Cellular Component
GO:0005634 nucleus Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0009506 plasmodesma Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0009548 plasmodesmatal plasma membrane Cellular Component
GO:0004672 protein kinase activity Molecular Function
GO:0005524 ATP binding Molecular Function
KEGG gene cross-reference
ath:AT1G53730
ath:AT2G20850
ath:AT4G03390
ath:AT4G22130
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.854
Rank 1 · TkA05G099000 · TK1151
Cytoplasm0.080
Rank 2 · TkA05G099000 · TK1151
Endoplasmic reticulum0.078
Rank 3 · TkA05G099000 · TK1151
Nucleus0.061
Rank 4 · TkA05G099000 · TK1151
Lysosome / Vacuole0.023
Rank 5 · TkA05G099000 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263LRRNT_230-69 aa
PF23211LRR_LRWD175-154 aa
PF12799LRR_488-109 aa
PF13855LRR_892-117 aa
PF24048LRR_NXF1-594-107 aa
PF24141LRR_ComC96-186 aa
PF00560LRR_198-117 aa
PF13855LRR_8121-179 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA05G099000PF08263LRRNT_230699.4e-0729.7
TkA05G099000PF23211LRR_LRWD1751540.004617.4
TkA05G099000PF12799LRR_4881096.9e-0936.4
TkA05G099000PF13855LRR_8921172.1e-1144.1
TkA05G099000PF24048LRR_NXF1-5941071.29.5
TkA05G099000PF24141LRR_ComC961860.003217.9
TkA05G099000PF00560LRR_1981171.4e-1348.8
TkA05G099000PF13855LRR_81211792.1e-1144.1
TkA05G099000PF12799LRR_41211596.9e-0936.4
TkA05G099000PF00560LRR_11221411.4e-1348.8
TkA05G099000PF24048LRR_NXF1-51281801.29.5
TkA05G099000PF23598LRR_141392180.01814.5
TkA05G099000PF00560LRR_11451661.4e-1348.8
TkA05G099000PF23211LRR_LRWD11602250.004617.4
TkA05G099000PF24048LRR_NXF1-51672241.29.5
TkA05G099000PF00560LRR_11691901.4e-1348.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q6R2K3Arabidopsis thalianasp|Q6R2K3|SRF3_ARATH Protein STRUBBELIG-RECEPTOR FAMILY 359.100%Swiss-ProtHigh
Q06BH3Arabidopsis thalianasp|Q06BH3|SRF1_ARATH Protein STRUBBELIG-RECEPTOR FAMILY 153.300%Swiss-ProtHigh
Q8RWZ1Arabidopsis thalianasp|Q8RWZ1|SUB_ARATH Protein STRUBBELIG45.100%Swiss-ProtMedium
Q9C8M9Arabidopsis thalianasp|Q9C8M9|SRF6_ARATH Protein STRUBBELIG-RECEPTOR FAMILY 641.900%Swiss-ProtMedium
Q6R2J8Arabidopsis thalianasp|Q6R2J8|SRF8_ARATH Protein STRUBBELIG-RECEPTOR FAMILY 861.100%Swiss-ProtLow

JBrowse

View in Genome Browser