LXL04_019876 | RubberDandelionOmics

Gene overview

LXL04_019876

Reference: OH-1004 Chr: Chr04 Coordinates: 42765910-42770364 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2406 bp · LXL04_019876|LXL04_019876|OH1004|cDNA

ATGGGTGTCGAGAGATCTGTAATTTACTTGTTGCTATTCTTAGGGTTTGTATTGATCTTCGTGGGCCCAATTTCTCTTGCTACCAATCCTGCAGATGTTAGTGCAATAAATAAACTATATGTTGCATTGGGATCTCCACCACTTCCCGGATGGACGGCTAGTGCTGGAGACCCGTGTATCGAGAATTGGCAAGGTGTTACATGTGACCTTACTAAAACAAACATCTTATCAATAGTTGTTCATGGTGCCAATTTAGTAGG...

CDS

Download CDS FASTA

2406 bp · LXL04_019876|LXL04_019876|OH1004|CDS

ATGGGTGTCGAGAGATCTGTAATTTACTTGTTGCTATTCTTAGGGTTTGTATTGATCTTCGTGGGCCCAATTTCTCTTGCTACCAATCCTGCAGATGTTAGTGCAATAAATAAACTATATGTTGCATTGGGATCTCCACCACTTCCCGGATGGACGGCTAGTGCTGGAGACCCGTGTATCGAGAATTGGCAAGGTGTTACATGTGACCTTACTAAAACAAACATCTTATCAATAGTTGTTCATGGTGCCAATTTAGTAGG...

Protein

Download Protein FASTA

801 aa · LXL04_019876|LXL04_019876|OH1004|PROTEIN

MGVERSVIYLLLFLGFVLIFVGPISLATNPADVSAINKLYVALGSPPLPGWTASAGDPCIENWQGVTCDLTKTNILSIVVHGANLVGELGDTLGSFTSLQSIDLSNNLIGGSIPTAFPVTVTTIFLADNNFTGTIPIFLTSMTQLTALSLNDNKLSGEIPDFFEGLTGLVNLDLSSNDLSGELPSSLQSLSSLTTFNLQNNQLSGTLDVLQDLPLTNLNVENNLFNGPIPAKLLAIPNFRNEGNLFNSTSTAPLSPPSSP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019876`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019876

Location Chr04:42765910-42770364 (-)

Description Similar to SRF3: Protein STRUBBELIG-RECEPTOR FAMILY 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g03390`	Not essential for epidermal patterning and not redundant with STRUBBELIG.	The role of the SCRAMBLED receptor-like kinase in patterning the Arabidopsis root epidermis.2007 · DOI: 10.1016/j.ydbio.2006.09.009
`At2g20850`	Not essential for epidermal patterning and not redundant with STRUBBELIG.	The role of the SCRAMBLED receptor-like kinase in patterning the Arabidopsis root epidermis.2007 · DOI: 10.1016/j.ydbio.2006.09.009 Molecular characterisation of the STRUBBELIG-RECEPTOR FAMILY of genes encoding putative leucine-rich repeat receptor-like kinases in Arabidopsis thaliana.2007 · DOI: 10.1186/1471-2229-7-16
`At1g53730`	Protein STRUBBELIG-RECEPTOR FAMILY 6.	No verified direct reference in this release
`At4g22130`	Protein STRUBBELIG-RECEPTOR FAMILY 8.	No verified direct reference in this release
`At1g11130`	Regulates the expression of transcription factors that define the cell fates.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019876 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0052543 callose deposition in cell wall Biological Process

GO:0060586 multicellular organismal-level iron ion homeostasis Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009548 plasmodesmatal plasma membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G53730

ath:AT2G20850

ath:AT4G03390

ath:AT4G22130

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.853

Rank 1 · LXL04_019876 · OH-1004

Cytoplasm0.080

Rank 2 · LXL04_019876 · OH-1004

Endoplasmic reticulum0.079

Rank 3 · LXL04_019876 · OH-1004

Nucleus0.062

Rank 4 · LXL04_019876 · OH-1004

Lysosome / Vacuole0.023

Rank 5 · LXL04_019876 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263.18LRRNT_230-69 aa

PF13855.13LRR_8121-179 aa

PF00069.32Pkinase517-788 aa

PF07714.24PK_Tyr_Ser-Thr519-790 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019876	`PF08263.18`	LRRNT_2	30	69	1e-06	29.6
LXL04_019876	`PF13855.13`	LRR_8	121	179	2e-11	44.2
LXL04_019876	`PF00069.32`	Pkinase	517	788	1.3e-36	127.1
LXL04_019876	`PF07714.24`	PK_Tyr_Ser-Thr	519	790	3.2e-42	145.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6R2K3`	Arabidopsis thaliana	Protein STRUBBELIG-RECEPTOR FAMILY 3	58.500%	Swiss-Prot	strong database homology
`Q06BH3`	Arabidopsis thaliana	Protein STRUBBELIG-RECEPTOR FAMILY 1	53.416%	Swiss-Prot	strong database homology
`Q9C8M9`	Arabidopsis thaliana	Protein STRUBBELIG-RECEPTOR FAMILY 6	38.010%	Swiss-Prot	moderate database homology
`Q6R2J8`	Arabidopsis thaliana	Protein STRUBBELIG-RECEPTOR FAMILY 8	56.667%	Swiss-Prot	weak database homology
`Q8RWZ1`	Arabidopsis thaliana	Protein STRUBBELIG	59.107%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card