TkA05G095240 | RubberDandelionOmics

Gene overview

TkA05G095240

Reference: TK1151 Chr: Chr05 Coordinates: 25704892-25705985 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

632 bp · TkA05G095240|TK1151|cDNA

AAACCTTCTTCGTCTCTTTTCGCTATTAGGGTTTCAAAGACTCTCCGTTCCAGGTGAGGCTCATACAGTTATAGCCGTAATCCATGGCTCGGATCAAAGTTCATGAGTTGAGGGACAAATCGAAGGTCGATTTGTTTGCTCAATTGAAGGATCTTAAAGCTGAGCTCGCTCTTCTCCGTGTCGCTAAAGTCACCGGCGGTGCTCCTAACAAGCTCTCCAAAATTAAAGTGGTGAGGACATCAATTGCACAGGTGTTGACT...

CDS

Download CDS FASTA

441 bp · TkA05G095240|TK1151|CDS

ATTATCTTTCTCGATTTTGATTCATATACATTCGTTGTCTTATTTATTCATCACTTGCTACGTAAAAATGCAGCTCGGATCAAAGTTCATGAGTTGAGGGACAAATCGAAGGTCGATTTGTTTGCTCAATTGAAGGATCTTAAAGCTGAGCTCGCTCTTCTCCGTGTCGCTAAAGTCACCGGCGGTGCTCCTAACAAGCTCTCCAAAATTAAAGTGGTGAGGACATCAATTGCACAGGTGTTGACTGTTATTTCACAGAC...

Protein

Download Protein FASTA

146 aa · TkA05G095240|TK1151|PROTEIN

IIFLDFDSYTFVVLFIHHLLRKNAARIKVHELRDKSKVDLFAQLKDLKAELALLRVAKVTGGAPNKLSKIKVVRTSIAQVLTVISQTQKAKLREAYKNKKYLPLDLRPKKTRAIRRRLTKHQVSLKTEREKKKEKYFPLRKYAIKV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G095240`
TK1151 ID	TkA05G095240
OH-1004 ID	LXL04_021983
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.100
Protein coverage (%)	TK1151 73.288 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G095240

Location Chr05:25704892-25705985 (+)

Description No functional description available

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g39390`	Large ribosomal subunit protein uL29y.	No verified direct reference in this release
`At5g02610`	Large ribosomal subunit protein uL29w.	No verified direct reference in this release
`At3g09500`	Large ribosomal subunit protein uL29z.	No verified direct reference in this release
`At3g55170`	Large ribosomal subunit protein uL29x.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021983 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000463 maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process

GO:0006412 translation Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0022625 cytosolic large ribosomal subunit Cellular Component

GO:0022626 cytosolic ribosome Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G39390

ath:AT3G09500

ath:AT3G55170

ath:AT5G02610

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.532

Rank 1 · TkA05G095240 · TK1151

Mitochondrion0.157

Rank 2 · TkA05G095240 · TK1151

Plastid0.144

Rank 3 · TkA05G095240 · TK1151

Nucleus0.140

Rank 4 · TkA05G095240 · TK1151

Peroxisome0.030

Rank 5 · TkA05G095240 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03094Mlo11-121 aa

PF06261LktC12-29 aa

PF00831Ribosomal_L2920-28 aa

PF12658Ten130-87 aa

PF00831Ribosomal_L2931-86 aa

PF15332LIME148-108 aa

PF06261LktC77-125 aa

PF00831Ribosomal_L29107-117 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G095240	`PF03094`	Mlo	11	121	0.02	14.0
TkA05G095240	`PF06261`	LktC	12	29	4.4	7.9
TkA05G095240	`PF00831`	Ribosomal_L29	20	28	2.3e-16	60.2
TkA05G095240	`PF12658`	Ten1	30	87	0.11	13.3
TkA05G095240	`PF00831`	Ribosomal_L29	31	86	2.3e-16	60.2
TkA05G095240	`PF15332`	LIME1	48	108	0.072	13.2
TkA05G095240	`PF06261`	LktC	77	125	4.4	7.9
TkA05G095240	`PF00831`	Ribosomal_L29	107	117	2.3e-16	60.2
TkA05G095240	`PF00831`	Ribosomal_L29	124	140	2.3e-16	60.2
TkA05G095240	`PF06261`	LktC	130	139	4.4	7.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80626`	Arabidopsis thaliana	sp\|O80626\|RL352_ARATH Large ribosomal subunit protein uL29y	88.600%	Swiss-Prot	High
`Q9LZ41`	Arabidopsis thaliana	sp\|Q9LZ41\|RL354_ARATH Large ribosomal subunit protein uL29w	89.400%	Swiss-Prot	High
`Q9SF53`	Arabidopsis thaliana	sp\|Q9SF53\|RL351_ARATH Large ribosomal subunit protein uL29z	88.600%	Swiss-Prot	High
`Q9M3D2`	Arabidopsis thaliana	sp\|Q9M3D2\|RL353_ARATH Large ribosomal subunit protein uL29x	87.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card