RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA05G038910
Reference: TK1151 Chr: Chr05 Coordinates: 10531239-10535310 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2004 bp · TkA05G038910|TK1151|cDNA

AAAGGGATGATAAGATTGATAATCATGCATAAGTGAATGCATGTTATAATGATAGTTGAAGAGTAAAGATTGAACAACTTAATGTTTCAATGTACATATGTTAAAAAACGTTTATACTTTTTATATTTCTAAAGTTTATGTAGAACAACACTAAATCTTAAGATTTGGAACACCAACAACCACAATGAAATGAATAATATATGCCCATGACCGTTGATTTCGTGATCCTATTGAAGCATTTAACCCATGATCCGCCGGCG...

CDS

Download CDS FASTA

1047 bp · TkA05G038910|TK1151|CDS

ATGAGCGATGGACAGCGGTTTCAGCTGGGAACGATCGGGGCGTTAGGTCTGTCGGTGGTTTCTTCTGTTTCGATTGTAATTTGCAACAAAGCGCTCATCAGCACCCTCGGTTTTACTTTCGCTACAACATTGACAAGCTGGCATCTTTTAGTCACATTTTGTTCCCTACATGTGGCGTTATGGATGAAATTTTTTGAGCACAAACCTTTTGATCCAAAAGCTGTCATGGGCTTTGGCATATTGAACGGGACCTCAATAGG...

Protein

Download Protein FASTA

348 aa · TkA05G038910|TK1151|PROTEIN

MSDGQRFQLGTIGALGLSVVSSVSIVICNKALISTLGFTFATTLTSWHLLVTFCSLHVALWMKFFEHKPFDPKAVMGFGILNGTSIGLLNLSLGFNSVGFYQMTKLAIIPCTVLLETLFFSKQFSKKIRFSLTILLMGVGIATVTDLQLNILGSVLSLLAVITTCIAQIMTNTIQKKYKVSSTQLLYQSCPYQALTLFLIGPFLDALLTNKNVFAFKYTPLVLAFIVLSCLISVSVNFSTFLVIGKTSPVTYQVLGHLKT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA05G038910
TK1151 IDTkA05G038910
OH-1004 IDLXL04_019298
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)100.000
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA05G038910
LocationChr05:10531239-10535310 (-)
DescriptionSimilar to UXT3: UDP-xylose transporter 3
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g06890 Nucleotide-sugar transporter that transports UDP-xylose and UMP in a strict counter-exchange mode.
Identification and Characterization of a Golgi-Localized UDP-Xylose Transporter Family from Arabidopsis.2015 · DOI: 10.1105/tpc.114.133827
At2g30460 Nucleotide-sugar transporter that transports UDP-xylose and UMP in a strict counter-exchange mode. No verified direct reference in this release
At2g28315 Nucleotide-sugar transporter that transports UDP-xylose and UMP in a strict counter-exchange mode.
Identification and Characterization of a Golgi-Localized UDP-Xylose Transporter Family from Arabidopsis.2015 · DOI: 10.1105/tpc.114.133827
At1g76670 Nucleotide-sugar transporter that transports UDP-rhamnose or UDP-galactose and UMP in a strict counter-exchange mode.
Molecular cloning of two Arabidopsis UDP-galactose transporters by complementation of a deficient Chinese hamster ovary cell line.2005 · DOI: 10.1093/glycob/cwh159
At1g21070 Nucleotide-sugar transporter that transports UDP-rhamnose or UDP-galactose and UMP in a strict counter-exchange mode. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_019298 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0009834 plant-type secondary cell wall biogenesis Biological Process
GO:0015790 UDP-xylose transmembrane transport Biological Process
GO:0055085 transmembrane transport Biological Process
GO:1900030 regulation of pectin biosynthetic process Biological Process
GO:1904659 D-glucose transmembrane transport Biological Process
GO:0000139 Golgi membrane Cellular Component
GO:0005768 endosome Cellular Component
GO:0005783 endoplasmic reticulum Cellular Component
GO:0005789 endoplasmic reticulum membrane Cellular Component
GO:0005794 Golgi apparatus Cellular Component
GO:0005802 trans-Golgi network Cellular Component
GO:0005886 plasma membrane Cellular Component
KEGG gene cross-reference
ath:AT1G06890
ath:AT1G34020
ath:AT2G28315
ath:AT2G30460
ath:AT4G09810
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.670
Rank 1 · TkA05G038910 · TK1151
Endoplasmic reticulum0.188
Rank 2 · TkA05G038910 · TK1151
Cytoplasm0.137
Rank 3 · TkA05G038910 · TK1151
Lysosome / Vacuole0.078
Rank 4 · TkA05G038910 · TK1151
Cell membrane0.055
Rank 5 · TkA05G038910 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00892EamA10-141 aa
PF04142Nuc_sug_transp20-64 aa
PF03151TPT21-294 aa
PF13567DUF413145-58 aa
PF04142Nuc_sug_transp98-146 aa
PF13567DUF4131111-147 aa
PF13179DUF4006155-184 aa
PF00892EamA158-294 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA05G038910PF00892EamA101415e-0730.8
TkA05G038910PF04142Nuc_sug_transp20640.01814.9
TkA05G038910PF03151TPT212941.9e-1764.3
TkA05G038910PF13567DUF413145580.2911.6
TkA05G038910PF04142Nuc_sug_transp981460.01814.9
TkA05G038910PF13567DUF41311111470.2911.6
TkA05G038910PF13179DUF40061551840.1412.5
TkA05G038910PF00892EamA1582945e-0730.8
TkA05G038910PF13567DUF41312122120.2911.6
TkA05G038910PF04142Nuc_sug_transp2303050.01814.9
TkA05G038910PF13567DUF41312613140.2911.6
TkA05G038910PF13179DUF40062792910.1412.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8RXL8Arabidopsis thalianasp|Q8RXL8|UXT3_ARATH UDP-xylose transporter 381.800%Swiss-ProtHigh
Q8GUJ1Arabidopsis thalianasp|Q8GUJ1|UXT2_ARATH UDP-xylose transporter 281.600%Swiss-ProtHigh
F4IHS9Arabidopsis thalianasp|F4IHS9|UXT1_ARATH UDP-xylose transporter 168.500%Swiss-ProtHigh
Q9SRE4Arabidopsis thalianasp|Q9SRE4|URGT1_ARATH UDP-rhamnose/UDP-galactose transporter 138.400%Swiss-ProtMedium
Q9LPU2Arabidopsis thalianasp|Q9LPU2|URGT2_ARATH UDP-rhamnose/UDP-galactose transporter 237.600%Swiss-ProtMedium

JBrowse

View in Genome Browser