TkA05G038190 | RubberDandelionOmics

Gene overview

TkA05G038190

Reference: TK1151 Chr: Chr05 Coordinates: 10315833-10319914 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2052 bp · TkA05G038190|TK1151|cDNA

AATTTAGGAGTGAGGATGTACCGATGTATTTCCAGTAGCAATCAGGAGTACCCGCCAAACACAGTCGCATCGGTTCGGAACAAGACTCGAGTTTCGGGTCTAGAGTCGGTCTACCTCACCGATTGTTGCGCTTTATCTCAGAAAATTGGATTCTTCCATCCACTTTTACCGACGAATCGTAAGATTTTAGAGAGAGCGACGGCGACAATCAAATGGGGTTAGGCTTACTAACTTCACCAGCTCTTCGATCATCTTCATCT...

CDS

Download CDS FASTA

1692 bp · TkA05G038190|TK1151|CDS

ATGGGGTTAGGCTTACTAACTTCACCAGCTCTTCGATCATCTTCATCTAGGTTTGTATCAGCAAACGCTAGATGCATTCTCATCAGAACCATCTTCTCTACACACGAGCTCAGCAAACCAGTAGCTCTCAGTTCAGAGGTTGAATTGGGCGTTGGTAAATTAGCTGGAGCTAACCTATTCATCTCCGGTCATAGGCGTATGCGTCTGTTCAAGGCTGAGAAGTCGCAGAGACCAAATTCTTCTATCCTAATGGCATTACT...

Protein

Download Protein FASTA

563 aa · TkA05G038190|TK1151|PROTEIN

MGLGLLTSPALRSSSSRFVSANARCILIRTIFSTHELSKPVALSSEVELGVGKLAGANLFISGHRRMRLFKAEKSQRPNSSILMALLPALFLGLSSTPAMAEDSSTETDLGGLTKIEDGSVVSNIHTSKWRIFTDNGRDLFLQGKLEDAERLFVGALEEAKEGFGERDPHVASACNNLAELYRVKKAFDKAEPLYLEAISILEESYGHDDIRVGAALHNLGQFYLIQNELDRARACYERALKIKKRVLGENHAEYAETMY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G038190`
TK1151 ID	TkA05G038190
OH-1004 ID	LXL04_019285
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G038190`
Location	Chr05:10315833-10319914 (+)
Description	Similar to Klc3: Kinesin light chain 3
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_019285` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0007018 microtubule-based movement Biological Process GO:0007283 spermatogenesis Biological Process GO:0007286 spermatid development Biological Process GO:0009116 nucleoside metabolic process Biological Process GO:0120317 sperm mitochondrial sheath assembly Biological Process GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0005871 kinesin complex Cellular Component GO:0005874 microtubule Cellular Component GO:0031514 motile cilium Cellular Component GO:0035253 ciliary rootlet Cellular Component GO:0003777 microtubule motor activity Molecular Function
KEGG gene cross-reference	hsa:89953 rno:171549 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.803

Rank 1 · TkA05G038190 · TK1151

Mitochondrion0.203

Rank 2 · TkA05G038190 · TK1151

Cytoplasm0.055

Rank 3 · TkA05G038190 · TK1151

Nucleus0.042

Rank 4 · TkA05G038190 · TK1151

Peroxisome0.026

Rank 5 · TkA05G038190 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30484ETO1_C58-86 aa

PF29407CFAP70_TPR_C99-200 aa

PF13432TPR_16135-199 aa

PF13424TPR_12136-204 aa

PF24885TPR_NPHP3136-247 aa

PF13374TPR_10137-170 aa

PF07719TPR_2137-160 aa

PF07721TPR_4137-152 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G038190	`PF30484`	ETO1_C	58	86	4.4e-05	23.5
TkA05G038190	`PF29407`	CFAP70_TPR_C	99	200	4.7e-06	27.0
TkA05G038190	`PF13432`	TPR_16	135	199	2e-08	35.3
TkA05G038190	`PF13424`	TPR_12	136	204	8.4e-38	129.1
TkA05G038190	`PF24885`	TPR_NPHP3	136	247	1.2e-17	64.8
TkA05G038190	`PF13374`	TPR_10	137	170	2.1e-33	114.1
TkA05G038190	`PF07719`	TPR_2	137	160	2.3e-12	46.7
TkA05G038190	`PF07721`	TPR_4	137	152	8.4e-06	26.6
TkA05G038190	`PF13414`	TPR_11	137	149	0.0072	16.7
TkA05G038190	`PF17874`	TPR_MalT	140	204	1.6e-15	57.9
TkA05G038190	`PF00515`	TPR_1	140	153	1e-13	51.2
TkA05G038190	`PF14559`	TPR_19	140	193	5e-09	37.1
TkA05G038190	`PF13428`	TPR_14	140	159	0.0066	17.8
TkA05G038190	`PF13176`	TPR_7	143	161	2.5e-08	34.1
TkA05G038190	`PF09986`	DUF2225	146	255	0.028	14.9
TkA05G038190	`PF21325`	SHPRH_helical-1st	164	218	0.018	15.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card