LXL04_019285 | RubberDandelionOmics

Gene overview

LXL04_019285

Reference: OH-1004 Chr: Chr04 Coordinates: 28141935-28145588 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1692 bp · LXL04_019285|LXL04_019285|OH1004|cDNA

ATGGGGTTAGGCTTACTAACTTCACCAGCTCTTCGATCATCTTCATCTAGGTTTGTATCAGCAAACGCTAGATGCATTCTCATCAGAACCATCTTCTCTACACACGAGCTCAGCAAACCAGTAGCTCTCAGTTCAGAGGTTGAATTGGGCGTTGGTAAATTAGCTGGAGCTAACCTATTCATCTCCGGTAATAGGCCTATGCGTCTGTTCAAGGCGGAGAAGTCGCAGAGACCAAATTCTTCTATCCTAGTGGCATTACT...

CDS

Download CDS FASTA

1692 bp · LXL04_019285|LXL04_019285|OH1004|CDS

ATGGGGTTAGGCTTACTAACTTCACCAGCTCTTCGATCATCTTCATCTAGGTTTGTATCAGCAAACGCTAGATGCATTCTCATCAGAACCATCTTCTCTACACACGAGCTCAGCAAACCAGTAGCTCTCAGTTCAGAGGTTGAATTGGGCGTTGGTAAATTAGCTGGAGCTAACCTATTCATCTCCGGTAATAGGCCTATGCGTCTGTTCAAGGCGGAGAAGTCGCAGAGACCAAATTCTTCTATCCTAGTGGCATTACT...

Protein

Download Protein FASTA

563 aa · LXL04_019285|LXL04_019285|OH1004|PROTEIN

MGLGLLTSPALRSSSSRFVSANARCILIRTIFSTHELSKPVALSSEVELGVGKLAGANLFISGNRPMRLFKAEKSQRPNSSILVALLPALFLGLNSTPAMAEDSSSETDLGGLTKIEDGSVVSNIHTSKWRIFTDNGRDLFLQGKLEDAERLFVGALEEAKEGFGERDPHVASACNNLAELYRVKKAFDKAEPLYLEAISILEESYGHDDIRVGAALHNLGQFYLIQNELDRARACYERALKIKKRVLGENHAEYAETMY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019285`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_019285`
Location	Chr04:28141935-28145588 (+)
Description	Similar to Klc3: Kinesin light chain 3
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_019285` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0007018 microtubule-based movement Biological Process GO:0007283 spermatogenesis Biological Process GO:0007286 spermatid development Biological Process GO:0009116 nucleoside metabolic process Biological Process GO:0120317 sperm mitochondrial sheath assembly Biological Process GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0005871 kinesin complex Cellular Component GO:0005874 microtubule Cellular Component GO:0031514 motile cilium Cellular Component GO:0035253 ciliary rootlet Cellular Component GO:0003777 microtubule motor activity Molecular Function
KEGG gene cross-reference	hsa:89953 rno:171549 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.873

Rank 1 · LXL04_019285 · OH-1004

Mitochondrion0.133

Rank 2 · LXL04_019285 · OH-1004

Cytoplasm0.045

Rank 3 · LXL04_019285 · OH-1004

Nucleus0.038

Rank 4 · LXL04_019285 · OH-1004

Peroxisome0.021

Rank 5 · LXL04_019285 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13432.13TPR_16135-199 aa

PF13424.13TPR_12136-204 aa

PF24885.2TPR_NPHP3136-247 aa

PF13374.13TPR_10171-210 aa

PF13424.13TPR_12174-245 aa

PF13424.13TPR_12214-288 aa

PF17874.8TPR_MalT214-471 aa

PF13374.13TPR_10215-253 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019285	`PF13432.13`	TPR_16	135	199	1.3e-08	35.8
LXL04_019285	`PF13424.13`	TPR_12	136	204	6.3e-38	129.5
LXL04_019285	`PF24885.2`	TPR_NPHP3	136	247	2.6e-18	67.0
LXL04_019285	`PF13374.13`	TPR_10	171	210	1.3e-33	114.7
LXL04_019285	`PF13424.13`	TPR_12	174	245	6.3e-38	129.5
LXL04_019285	`PF13424.13`	TPR_12	214	288	6.3e-38	129.5
LXL04_019285	`PF17874.8`	TPR_MalT	214	471	1.1e-15	58.5
LXL04_019285	`PF13374.13`	TPR_10	215	253	1.3e-33	114.7
LXL04_019285	`PF07719.24`	TPR_2	215	244	2.4e-12	46.6
LXL04_019285	`PF00515.35`	TPR_1	216	244	1.2e-13	51.0
LXL04_019285	`PF13181.13`	TPR_8	216	245	1.9e-11	43.8
LXL04_019285	`PF13424.13`	TPR_12	341	395	6.3e-38	129.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card