TkA05G025920 | RubberDandelionOmics

Gene overview

TkA05G025920

Reference: TK1151 Chr: Chr05 Coordinates: 7060054-7061807 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1088 bp · TkA05G025920|TK1151|cDNA

TTACAAGTGATATAAGCCGTTCAACTAGGGTTTACCGGCAGAGTCGAAGGAGAGAGCGTTGTAGAGGACCGCCGCAGTTTCGCCGTACAAGTATCCCGGAGATTATTATCTCCTACTACACACGCCGCAGCCATGGCTCGAGGTTTGAAGAAGCACATGAAGAGGCTCAATGCCCCCAAGCATTGGATGCTCGATAAACTCGGTGGCGCTTTTGCACCCAAGCCGTCATCAGGCCCACACAAATCACGCGAATGCCTACC...

CDS

Download CDS FASTA

795 bp · TkA05G025920|TK1151|CDS

ATGGCTCGAGGTTTGAAGAAGCACATGAAGAGGCTCAATGCCCCCAAGCATTGGATGCTCGATAAACTCGGTGGCGCTTTTGCACCCAAGCCGTCATCAGGCCCACACAAATCACGCGAATGCCTACCCTTGATCCTCATTCTCCGTAACAGGCTCAAGTACGCCTTAACTTACCGCGAGGTCCAATCCATCTTAATGCAACGCCATATTCTTGTTGACAACAAGGTCAGAACCGACAAGACCTACCCTGCTGGTTTCAT...

Protein

Download Protein FASTA

264 aa · TkA05G025920|TK1151|PROTEIN

MARGLKKHMKRLNAPKHWMLDKLGGAFAPKPSSGPHKSRECLPLILILRNRLKYALTYREVQSILMQRHILVDNKVRTDKTYPAGFMDVVSIPKTNENFRLLYDTKGRFRLHSVRDEESKFKLCKVRSVQFGQKGIPYINTYDGRTIRYPDPLIKANDTIKLDLDTNKIVDFIKFDVGNVVMVTGGRNTGRVGILKNREKHKGSFETVHIQDSTGHEFATRLGNVFTVGKGSKPWVSLPKGKGIKLTIIEEARKRQAALA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G025920`
TK1151 ID	TkA05G025920
OH-1004 ID	LXL04_001175
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.900
Protein coverage (%)	TK1151 98.864 / OH-1004 83.654 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G025920

Location Chr05:7060054-7061807 (+)

Description Similar to RPS4: 40S ribosomal protein S4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g58420`	Small ribosomal subunit protein eS4x.	No verified direct reference in this release
`At2g17360`	Small ribosomal subunit protein eS4z.	No verified direct reference in this release
`At5g07090`	Small ribosomal subunit protein eS4y.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001175 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006412 translation Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0022626 cytosolic ribosome Cellular Component

GO:0022627 cytosolic small ribosomal subunit Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

GO:0003735 structural constituent of ribosome Molecular Function

KEGG gene cross-reference

ath:AT2G17360

ath:AT5G07090

ath:AT5G58420

sot:102604933

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.887

Rank 1 · TkA05G025920 · TK1151

Nucleus0.229

Rank 2 · TkA05G025920 · TK1151

Endoplasmic reticulum0.098

Rank 3 · TkA05G025920 · TK1151

Plastid0.025

Rank 4 · TkA05G025920 · TK1151

Mitochondrion0.022

Rank 5 · TkA05G025920 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08071RS4NT3-39 aa

PF00467KOW33-40 aa

PF01479S448-90 aa

PF00900Ribosomal_S4e95-169 aa

PF08269dCache_2125-164 aa

PF00467KOW177-210 aa

PF00900Ribosomal_S4e202-242 aa

PF1612140S_S4_C212-257 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G025920	`PF08071`	RS4NT	3	39	4.9e-18	65.5
TkA05G025920	`PF00467`	KOW	33	40	2e-06	28.1
TkA05G025920	`PF01479`	S4	48	90	1.3e-05	25.5
TkA05G025920	`PF00900`	Ribosomal_S4e	95	169	1.8e-33	114.9
TkA05G025920	`PF08269`	dCache_2	125	164	0.1	12.4
TkA05G025920	`PF00467`	KOW	177	210	2e-06	28.1
TkA05G025920	`PF00900`	Ribosomal_S4e	202	242	1.8e-33	114.9
TkA05G025920	`PF16121`	40S_S4_C	212	257	6.1e-25	87.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VYK6`	Arabidopsis thaliana	sp\|Q8VYK6\|RS43_ARATH Small ribosomal subunit protein eS4x	91.100%	Swiss-Prot	High
`Q93VH9`	Arabidopsis thaliana	sp\|Q93VH9\|RS41_ARATH Small ribosomal subunit protein eS4z	90.700%	Swiss-Prot	High
`P49204`	Arabidopsis thaliana	sp\|P49204\|RS42_ARATH Small ribosomal subunit protein eS4y	91.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card