LXL04_001175 | RubberDandelionOmics

Gene overview

LXL04_001175

Reference: OH-1004 Chr: Chr01 Coordinates: 21439839-21442015 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

939 bp · LXL04_001175|LXL04_001175|OH1004|cDNA

ATGCCGTATACACCACCCCGGCCCACTTCCGACAGGTTCAATAAAAGAGATCGTCAAGGAGGGTGTGCGGCTGCGAGTGAGGAGGAGAGGCGCAGTTTAACCGGACGAGACAACCGGAGATCTCAAAGTCATCACAACAACGTAACCATGGCTAGGGGTTTGAAGAAGCATATGAAGAGGCTCAATGCCCCAAAACATTGGATGCTTGATAAACTCGGCGGTGCTTTTGCTCCCAAACCTTCATCAGGACCACACAAATC...

CDS

Download CDS FASTA

939 bp · LXL04_001175|LXL04_001175|OH1004|CDS

ATGCCGTATACACCACCCCGGCCCACTTCCGACAGGTTCAATAAAAGAGATCGTCAAGGAGGGTGTGCGGCTGCGAGTGAGGAGGAGAGGCGCAGTTTAACCGGACGAGACAACCGGAGATCTCAAAGTCATCACAACAACGTAACCATGGCTAGGGGTTTGAAGAAGCATATGAAGAGGCTCAATGCCCCAAAACATTGGATGCTTGATAAACTCGGCGGTGCTTTTGCTCCCAAACCTTCATCAGGACCACACAAATC...

Protein

Download Protein FASTA

312 aa · LXL04_001175|LXL04_001175|OH1004|PROTEIN

MPYTPPRPTSDRFNKRDRQGGCAAASEEERRSLTGRDNRRSQSHHNNVTMARGLKKHMKRLNAPKHWMLDKLGGAFAPKPSSGPHKSRECLPLILILRNRLKYALTYREVQSILMQRHVLVDNKVRTDKTYPAGFMDVVSIPKTNENFRLLYDTKGRFRLHSVRDEESKFKLCKVRSVQFGQKGIPYINTYDGRTIRYPDPLIKANDTIKLDLESNKIVDFIKFDVGNVVMVTGGRNTGRVGILKNREKHKGSFETVHIQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001175`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_001175

Location Chr01:21439839-21442015 (-)

Description Similar to RPS4: 40S ribosomal protein S4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g58420`	Small ribosomal subunit protein eS4x.	No verified direct reference in this release
`At5g07090`	Small ribosomal subunit protein eS4y.	No verified direct reference in this release
`At2g17360`	Small ribosomal subunit protein eS4z.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001175 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006412 translation Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0022626 cytosolic ribosome Cellular Component

GO:0022627 cytosolic small ribosomal subunit Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

GO:0003735 structural constituent of ribosome Molecular Function

KEGG gene cross-reference

ath:AT2G17360

ath:AT5G07090

ath:AT5G58420

sot:102604933

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.788

Rank 1 · LXL04_001175 · OH-1004

Nucleus0.230

Rank 2 · LXL04_001175 · OH-1004

Plastid0.097

Rank 3 · LXL04_001175 · OH-1004

Endoplasmic reticulum0.067

Rank 4 · LXL04_001175 · OH-1004

Mitochondrion0.040

Rank 5 · LXL04_001175 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08071.18RS4NT52-88 aa

PF01479.31S497-139 aa

PF00900.27Ribosomal_S4e144-218 aa

PF00467.36KOW226-259 aa

PF16121.1140S_S4_C261-306 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001175	`PF08071.18`	RS4NT	52	88	6.6e-18	65.1
LXL04_001175	`PF01479.31`	S4	97	139	5.7e-06	26.7
LXL04_001175	`PF00900.27`	Ribosomal_S4e	144	218	3e-33	114.1
LXL04_001175	`PF00467.36`	KOW	226	259	2.8e-06	27.6
LXL04_001175	`PF16121.11`	40S_S4_C	261	306	7.4e-25	87.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VYK6`	Arabidopsis thaliana	Small ribosomal subunit protein eS4x	89.695%	Swiss-Prot	strong database homology
`P49204`	Arabidopsis thaliana	Small ribosomal subunit protein eS4y	89.695%	Swiss-Prot	strong database homology
`Q93VH9`	Arabidopsis thaliana	Small ribosomal subunit protein eS4z	90.038%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card