TkA05G025070 | RubberDandelionOmics

Gene overview

TkA05G025070

Reference: TK1151 Chr: Chr05 Coordinates: 6795457-6796026 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

570 bp · TkA05G025070|TK1151|cDNA

ATGGATTTCTTATTACACTACAGAAACCCTAATTTCCATTCTTCTTCAGTAGCCTTAACAAGCAATAAAGTCAACAACAAATTACATGCTGGGAGAGAAGTGGAGAAGAAGAAGAACAAGAGAAACAACAAGATCAGCACCAAAGTGAAGCTTTCAACAGACCCACAAAGTGTAGCTGCAAGAGAGAGAAGACACAGAATCAGCGAGCGATTCAAGATTCTGCGAAGCTTGATACCAGGTGGTGACACCAGGAACATGGA...

CDS

Download CDS FASTA

570 bp · TkA05G025070|TK1151|CDS

ATGGATTTCTTATTACACTACAGAAACCCTAATTTCCATTCTTCTTCAGTAGCCTTAACAAGCAATAAAGTCAACAACAAATTACATGCTGGGAGAGAAGTGGAGAAGAAGAAGAACAAGAGAAACAACAAGATCAGCACCAAAGTGAAGCTTTCAACAGACCCACAAAGTGTAGCTGCAAGAGAGAGAAGACACAGAATCAGCGAGCGATTCAAGATTCTGCGAAGCTTGATACCAGGTGGTGACACCAGGAACATGGA...

Protein

Download Protein FASTA

189 aa · TkA05G025070|TK1151|PROTEIN

MDFLLHYRNPNFHSSSVALTSNKVNNKLHAGREVEKKKNKRNNKISTKVKLSTDPQSVAARERRHRISERFKILRSLIPGGDTRNMDTVSMLEEAIQYVKFLKAQIWLQQTMISFENCDDYDNANRNYHHYDQYSHQNLLPSDIFNSDHHHLSSLPQMEHEIVPQLGFEDGSCFKVEDEDNMFSHGIIM

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G025070`
TK1151 ID	TkA05G025070
OH-1004 ID	LXL04_019167
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 97.884 / OH-1004 38.866 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G025070

Location Chr05:6795457-6796026 (+)

Description Similar to LAX1: Transcription factor LAX PANICLE 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g01310`	Transcription factor bHLH140.	No verified direct reference in this release
`At3g21330`	Transcription factor bHLH87.	No verified direct reference in this release
`At5g09750`	Required for the female reproductive tract development and fertility.	The HECATE genes regulate female reproductive tract development in Arabidopsis thaliana.2007 · DOI: 10.1242/dev.011510
`At3g50330`	Required for the female reproductive tract development and fertility.	The HECATE genes regulate female reproductive tract development in Arabidopsis thaliana.2007 · DOI: 10.1242/dev.011510

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0831000`	Transcription factor that seems to regulate organogenesis in postembryonic development.	LAX PANICLE2 of rice encodes a novel nuclear protein and regulates the formation of axillary meristems.2011 · DOI: 10.1105/tpc.111.088765

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019167 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000012 single strand break repair Biological Process

GO:0006260 DNA replication Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006790 sulfur compound metabolic process Biological Process

GO:0009150 purine ribonucleotide metabolic process Biological Process

GO:0010197 polar nucleus fusion Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0048586 regulation of long-day photoperiodism, flowering Biological Process

GO:0048587 regulation of short-day photoperiodism, flowering Biological Process

GO:2000032 regulation of secondary shoot formation Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT3G21330

ath:AT4G00120

dosa:Os01g0831000

dosa:Os05g0541400

osa:9269440

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.975

Rank 1 · TkA05G025070 · TK1151

Cytoplasm0.111

Rank 2 · TkA05G025070 · TK1151

Cell membrane0.020

Rank 3 · TkA05G025070 · TK1151

Endoplasmic reticulum0.015

Rank 4 · TkA05G025070 · TK1151

Plastid0.009

Rank 5 · TkA05G025070 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00010HLH37-47 aa

PF23173bHLH_SAC5139-51 aa

PF23177bHLH_IRO357-106 aa

PF00010HLH60-103 aa

PF23173bHLH_SAC5162-108 aa

PF23176bHLH_LHW64-103 aa

PF06862Utp25_C85-136 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G025070	`PF00010`	HLH	37	47	7.3e-10	39.2
TkA05G025070	`PF23173`	bHLH_SAC51	39	51	1.1e-09	38.7
TkA05G025070	`PF23177`	bHLH_IRO3	57	106	0.00049	21.1
TkA05G025070	`PF00010`	HLH	60	103	7.3e-10	39.2
TkA05G025070	`PF23173`	bHLH_SAC51	62	108	1.1e-09	38.7
TkA05G025070	`PF23176`	bHLH_LHW	64	103	0.0077	16.9
TkA05G025070	`PF06862`	Utp25_C	85	136	0.077	13.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M041`	Arabidopsis thaliana	sp\|Q9M041\|BH140_ARATH Transcription factor bHLH140	74.600%	Swiss-Prot	Low
`Q8S3D2`	Arabidopsis thaliana	sp\|Q8S3D2\|BH087_ARATH Transcription factor bHLH87	52.600%	Swiss-Prot	Low
`Q9LXD8`	Arabidopsis thaliana	sp\|Q9LXD8\|HEC3_ARATH Transcription factor HEC3	63.900%	Swiss-Prot	Low
`Q9SND4`	Arabidopsis thaliana	sp\|Q9SND4\|HEC2_ARATH Transcription factor HEC2	67.200%	Swiss-Prot	Low
`Q7XAQ6`	Oryza sativa subsp. japonica	sp\|Q7XAQ6\|LAX1_ORYSJ Transcription factor LAX PANICLE 1	66.700%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card