LXL04_019167 | RubberDandelionOmics

Gene overview

LXL04_019167

Reference: OH-1004 Chr: Chr04 Coordinates: 25184157-25189445 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1431 bp · LXL04_019167|LXL04_019167|OH1004|cDNA

ATGGATTTCTTATTACACTACAGAAACCCTAATTTCCATTCTTCTTCAGTAGCCTTAACAAGCAATAAAGTCAACAACAAATTACATGCTGGGagagaagtggagaagaagaagaacaagagaAACAACAAGATCAGCACCAAAGTGAAGCTTTCAACAGACCCACAAAGTGTAGCTGCAAGAGAGAGAAGACACAGAATCAGCGAGCGATTCAAGATTCTGCGAAGCTTGATACCAGGTGGTGACACCAGGAACATGGA...

CDS

Download CDS FASTA

1431 bp · LXL04_019167|LXL04_019167|OH1004|CDS

ATGGATTTCTTATTACACTACAGAAACCCTAATTTCCATTCTTCTTCAGTAGCCTTAACAAGCAATAAAGTCAACAACAAATTACATGCTGGGAGAGAAGTGGAGAAGAAGAAGAACAAGAGAAACAACAAGATCAGCACCAAAGTGAAGCTTTCAACAGACCCACAAAGTGTAGCTGCAAGAGAGAGAAGACACAGAATCAGCGAGCGATTCAAGATTCTGCGAAGCTTGATACCAGGTGGTGACACCAGGAACATGGA...

Protein

Download Protein FASTA

476 aa · LXL04_019167|LXL04_019167|OH1004|PROTEIN

MDFLLHYRNPNFHSSSVALTSNKVNNKLHAGREVEKKKNKRNNKISTKVKLSTDPQSVAARERRHRISERFKILRSLIPGGDTRNMDTVSMLEEAIQYVKFLKAQIWLQQTMISFENCDDYDNANRNYHHYDQYSHQNLLPSDIFNSDHHHLSSLPQMEHEIVPQLGFEDGSCFKVEDEDNMFSHVPNKVLAQLEAICCRFFWGSRENERIILWVAWKVAMNSLDQGGLGIGSLRAGNIARLMHSLQEIWVLAATPLAAT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019167`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019167

Location Chr04:25184157-25189445 (+)

Description Similar to LAX1: Transcription factor LAX PANICLE 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g01310`	Transcription factor bHLH140.	No verified direct reference in this release
`At3g21330`	Transcription factor bHLH87.	No verified direct reference in this release
`At4g00120`	Transcription regulator required for seed dispersal.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0831000`	Transcription factor that seems to regulate organogenesis in postembryonic development.	LAX PANICLE2 of rice encodes a novel nuclear protein and regulates the formation of axillary meristems.2011 · DOI: 10.1105/tpc.111.088765
`Os05g0541400`	Transcription factor involved in the negative regulation of flowering.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019167 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000012 single strand break repair Biological Process

GO:0006260 DNA replication Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006790 sulfur compound metabolic process Biological Process

GO:0009150 purine ribonucleotide metabolic process Biological Process

GO:0010197 polar nucleus fusion Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0048586 regulation of long-day photoperiodism, flowering Biological Process

GO:0048587 regulation of short-day photoperiodism, flowering Biological Process

GO:2000032 regulation of secondary shoot formation Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT3G21330

ath:AT4G00120

dosa:Os01g0831000

dosa:Os05g0541400

osa:9269440

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.697

Rank 1 · LXL04_019167 · OH-1004

Cytoplasm0.274

Rank 2 · LXL04_019167 · OH-1004

Cell membrane0.074

Rank 3 · LXL04_019167 · OH-1004

Endoplasmic reticulum0.057

Rank 4 · LXL04_019167 · OH-1004

Golgi apparatus0.030

Rank 5 · LXL04_019167 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00010.32HLH60-103 aa

PF23173.3bHLH_SAC5162-106 aa

PF13966.12zf-RVT327-409 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019167	`PF00010.32`	HLH	60	103	1.6e-10	41.3
LXL04_019167	`PF23173.3`	bHLH_SAC51	62	106	1.7e-10	41.4
LXL04_019167	`PF13966.12`	zf-RVT	327	409	1.6e-15	58.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M041`	Arabidopsis thaliana	Transcription factor bHLH140	55.172%	Swiss-Prot	weak database homology
`Q8S3D2`	Arabidopsis thaliana	Transcription factor bHLH87	46.875%	Swiss-Prot	weak database homology
`O81313`	Arabidopsis thaliana	Transcription factor IND	52.000%	Swiss-Prot	weak database homology
`Q7XAQ6`	Oryza sativa subsp. japonica	Transcription factor LAX PANICLE 1	73.846%	Swiss-Prot	weak database homology
`A0A0P0WQ90`	Oryza sativa subsp. japonica	Transcription factor LATE FLOWERING	53.968%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card