TkA05G005520 | RubberDandelionOmics

Gene overview

TkA05G005520

Reference: TK1151 Chr: Chr05 Coordinates: 1642563-1645199 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1967 bp · TkA05G005520|TK1151|cDNA

CCAGACTCCAGAGTCGGACTCCTCCGATCAAATTTGTTTTAGTGGTCCTGAGTGGCATAAACCTCGGTAGGCTATTGCGAGGAGGCAATCAGCAGGGCAAAGCGAGGCACTGAGAATGGTAGTTCGATGCAAGTTTTGGCTGGTAAAGAAGAAGAGATTTTGTGCAATCCCGCCGCTCCCCGATTCCGAGTTTTGTGGCAACCACTCTACAAGGCCGGATGACAAGTGGATTCTGTGCTCGATAGATCCCTCCCACTCTG...

CDS

Download CDS FASTA

1275 bp · TkA05G005520|TK1151|CDS

ATGGTAGTTCGATGCAAGTTTTGGCTGGTAAAGAAGAAGAGATTTTGTGCAATCCCGCCGCTCCCCGATTCCGAGTTTTGTGGCAACCACTCTACAAGGCCGGATGACAAGTGGATTCTGTGCTCGATAGATCCCTCCCACTCTGTACTGGAATCCAACCTCGAGAACCACCTTAGACGGTGTCCGTTGCTCAAACATAACAACTCGCTGTCCCTCCAATCTTTCTACCAAAAGGGCATTAATGGAGGCGATGAAGAAGA...

Protein

Download Protein FASTA

424 aa · TkA05G005520|TK1151|PROTEIN

MVVRCKFWLVKKKRFCAIPPLPDSEFCGNHSTRPDDKWILCSIDPSHSVLESNLENHLRRCPLLKHNNSLSLQSFYQKGINGGDEEDEDVSSESKRMAVHTIAAPDLIKLFRKIKSVHALICKNIQDSYNVPQACRMWIDRSVDWKTPFQEKHVIQQASILGNLEKLGALKSSSSSSSSVGEGEQLAVVEFGAGRGYLTQMLADCYGVSKVFLIERKSYKLKADRSLRQKESLTLERLRIDIEDLDLNAIESLQGVPYLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G005520`
TK1151 ID	TkA05G005520
OH-1004 ID	LXL04_018961
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.100
Protein coverage (%)	TK1151 100.000 / OH-1004 85.743 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G005520

Location Chr05:1642563-1645199 (-)

Description Similar to TRM13: tRNA:m(4)X modification enzyme TRM13

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0833200`	tRNA methylase that catalyzes 2'-O-methyladenosine (Am) nucleoside formation on tRNA(Gly)(GCC) in vitro.	The 2'-O-methyladenosine nucleoside modification gene OsTRM13 positively regulates salt stress tolerance in rice.2017 · DOI: 10.1093/jxb/erx061

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018961 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002128 tRNA nucleoside ribose methylation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0030488 tRNA methylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0008175 tRNA methyltransferase activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0106050 tRNA 2'-O-methyltransferase activity Molecular Function

KEGG gene cross-reference

dosa:Os03g0833200

hsa:54482

kla:KLLA0_E07547g

mmu:229780

vpo:Kpol_1076p3

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.701

Rank 1 · TkA05G005520 · TK1151

Cytoplasm0.332

Rank 2 · TkA05G005520 · TK1151

Mitochondrion0.051

Rank 3 · TkA05G005520 · TK1151

Cell membrane0.037

Rank 4 · TkA05G005520 · TK1151

Endoplasmic reticulum0.029

Rank 5 · TkA05G005520 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11722zf-TRM13_CCCH4-30 aa

PF08242Methyltransf_1239-63 aa

PF05253zf-U11-48K40-62 aa

PF13649Methyltransf_2598-117 aa

PF05253zf-U11-48K99-104 aa

PF05253zf-U11-48K148-156 aa

PF05206TRM13155-422 aa

PF13679Methyltransf_32180-301 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G005520	`PF11722`	zf-TRM13_CCCH	4	30	3.2e-13	49.7
TkA05G005520	`PF08242`	Methyltransf_12	39	63	0.011	17.1
TkA05G005520	`PF05253`	zf-U11-48K	40	62	8.2e-06	26.3
TkA05G005520	`PF13649`	Methyltransf_25	98	117	0.0052	18.2
TkA05G005520	`PF05253`	zf-U11-48K	99	104	8.2e-06	26.3
TkA05G005520	`PF05253`	zf-U11-48K	148	156	8.2e-06	26.3
TkA05G005520	`PF05206`	TRM13	155	422	5.6e-80	269.3
TkA05G005520	`PF13679`	Methyltransf_32	180	301	1.4e-08	35.5
TkA05G005520	`PF13847`	Methyltransf_31	185	309	0.0047	17.4
TkA05G005520	`PF13649`	Methyltransf_25	188	247	0.0052	18.2
TkA05G005520	`PF08242`	Methyltransf_12	189	247	0.011	17.1
TkA05G005520	`PF08241`	Methyltransf_11	190	248	0.27	12.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q10B19`	Oryza sativa subsp. japonica	sp\|Q10B19\|TRM13_ORYSJ tRNA:m(4)X modification enzyme TRM13	50.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card