RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA04G505750
Reference: TK1151 Chr: Chr04 Coordinates: 127760519-127761319 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

801 bp · TkA04G505750|TK1151|cDNA

ATGGAGTTACCGCGTGAGAAACCTTCCACCAAGGTCAACCCAACAATGGCGATTATACTGGTGTGCATTTTAAGTGCCTTCTTCATGATATGTGTCGTCTCCACTTACTTCCGCCATTTTACTGAACGACAACTCAGACTTGCTGGGAGTACACAGACCCGAAGTGAAACAGGGTCAACCAGATCGGTGGTTCATGGGCTTGATCCATCAGTGATTGCCACCTTCCCACGCTTCTTGTATTCTAGTGTGAAGGGGATAAA...

CDS

Download CDS FASTA

801 bp · TkA04G505750|TK1151|CDS

ATGGAGTTACCGCGTGAGAAACCTTCCACCAAGGTCAACCCAACAATGGCGATTATACTGGTGTGCATTTTAAGTGCCTTCTTCATGATATGTGTCGTCTCCACTTACTTCCGCCATTTTACTGAACGACAACTCAGACTTGCTGGGAGTACACAGACCCGAAGTGAAACAGGGTCAACCAGATCGGTGGTTCATGGGCTTGATCCATCAGTGATTGCCACCTTCCCACGCTTCTTGTATTCTAGTGTGAAGGGGATAAA...

Protein

Download Protein FASTA

266 aa · TkA04G505750|TK1151|PROTEIN

MELPREKPSTKVNPTMAIILVCILSAFFMICVVSTYFRHFTERQLRLAGSTQTRSETGSTRSVVHGLDPSVIATFPRFLYSSVKGIKIGQTVLECAVCLNEFQDHETLRLLPKCSHVFHQDCIDTWLVSHVTCPVCRANLVVRPGELDHVTESSLHLPVDPEIDFASTEFLLPIESKHKIPPTTEMPRSHSTGHSVVVRPVENTERYTLRLPSEARSLFGNNIAFPMESSQKMSLRSVSVGSVGRLDYSNYELCNHERHG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA04G505750
TK1151 IDTkA04G505750
OH-1004 IDLXL04_039123
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)99.600
Protein coverage (%)TK1151 100.000 / OH-1004 87.500
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA04G505750
LocationChr04:127760519-127761319 (+)
DescriptionSimilar to ATL6: E3 ubiquitin-protein ligase ATL6
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g05200 E3 ubiquitin-protein ligase able to catalyze polyubiquitination with ubiquitin-conjugating enzyme E2 UBC8 in vitro. No verified direct reference in this release
At5g27420 E3 ubiquitin-protein ligase that is required for the plant C/N response during seedling growth transition.
CNI1/ATL31, a RING-type ubiquitin ligase that functions in the carbon/nitrogen response for growth phase transition in Arabidopsis seedlings.2009 · DOI: 10.1111/j.1365-313x.2009.04006.x
At2g34990 RING-H2 finger protein ATL38. No verified direct reference in this release
At1g22500 E3 ubiquitin-protein ligase able to catalyze polyubiquitination with ubiquitin-conjugating enzyme E2 UBC8, UBC10, UBC11, UBC28 and UBC29 in vitro. No verified direct reference in this release
At1g35330 RING-H2 finger protein ATL34. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_039123 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0009416 response to light stimulus Biological Process
GO:0009737 response to abscisic acid Biological Process
GO:0016567 protein ubiquitination Biological Process
GO:0033591 response to L-ascorbic acid Biological Process
GO:0042742 defense response to bacterium Biological Process
GO:0043562 cellular response to nitrogen levels Biological Process
GO:0071456 cellular response to hypoxia Biological Process
GO:0098542 defense response to other organism Biological Process
GO:0005576 extracellular region Cellular Component
GO:0005739 mitochondrion Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0009507 chloroplast Cellular Component
KEGG gene cross-reference
ath:AT1G22500
ath:AT1G72200
ath:AT3G05200
ath:AT5G27420
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.279
Rank 1 · TkA04G505750 · TK1151
Cell membrane0.265
Rank 2 · TkA04G505750 · TK1151
Endoplasmic reticulum0.218
Rank 3 · TkA04G505750 · TK1151
Nucleus0.204
Rank 4 · TkA04G505750 · TK1151
Lysosome / Vacuole0.203
Rank 5 · TkA04G505750 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17034zinc_ribbon_1688-100 aa
PF11789zf-Nse89-136 aa
PF23413zf_RING_Vps8_fungal92-100 aa
PF11793FANCL_C93-131 aa
PF13639zf-RING_294-137 aa
PF17123zf-RING_1194-123 aa
PF13923zf-C3HC4_294-136 aa
PF14634zf-RING_594-137 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA04G505750PF17034zinc_ribbon_16881001.59.7
TkA04G505750PF11789zf-Nse891360.002918.1
TkA04G505750PF23413zf_RING_Vps8_fungal921001.78.7
TkA04G505750PF11793FANCL_C931310.4311.6
TkA04G505750PF13639zf-RING_2941371.5e-1454.7
TkA04G505750PF17123zf-RING_11941232.8e-1143.6
TkA04G505750PF13923zf-C3HC4_2941364.8e-0936.6
TkA04G505750PF14634zf-RING_5941376.7e-0626.7
TkA04G505750PF13920zf-C3HC4_3941390.002818.1
TkA04G505750PF17120zf-RING_16941350.003217.8
TkA04G505750PF14446Prok-RING_1941230.01815.9
TkA04G505750PF21202SLX1_C941361.69.8
TkA04G505750PF00097zf-C3HC4951363.1e-0730.8
TkA04G505750PF13445zf-RING_UBOX951342.8e-0627.9
TkA04G505750PF12906RINGv951360.06614.1
TkA04G505750PF06906DUF1272951440.1912.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8RXX9Arabidopsis thalianasp|Q8RXX9|ATL6_ARATH E3 ubiquitin-protein ligase ATL645.800%Swiss-ProtMedium
Q8LGA5Arabidopsis thalianasp|Q8LGA5|ATL31_ARATH E3 ubiquitin-protein ligase ATL3143.600%Swiss-ProtMedium
O64762Arabidopsis thalianasp|O64762|ATL38_ARATH RING-H2 finger protein ATL3837.300%Swiss-ProtMedium
Q9SK92Arabidopsis thalianasp|Q9SK92|ATL15_ARATH E3 ubiquitin-protein ligase ATL1537.300%Swiss-ProtMedium
Q9C7I1Arabidopsis thalianasp|Q9C7I1|ATL34_ARATH RING-H2 finger protein ATL3443.800%Swiss-ProtMedium

JBrowse

View in Genome Browser