LXL04_039123 | RubberDandelionOmics

Gene overview

LXL04_039123

Reference: OH-1004 Chr: Chr09 Coordinates: 59681740-59682654 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

915 bp · LXL04_039123|LXL04_039123|OH1004|cDNA

ATGCAGCTTCATATATTCTCCAATGAAAAAGAAATGGTTATTGTTGTTTTTATGTTACTCTCAGCAGATAGTTACTACGCCGTCATAGATGATGCAATCGCACCACCACCACCAATGGAGTTACCGCGTGAGAAACCTTCCACCAAGGTCAACCCAACAATGGCGATTATACTGGTGTGCATTTTAAGTGCCTTCTTCATGATATGTGTCGTCTCCACTTACTTCCGCCATTTTACTGAACGACAACTCAGACTTGCTGG...

CDS

Download CDS FASTA

915 bp · LXL04_039123|LXL04_039123|OH1004|CDS

ATGCAGCTTCATATATTCTCCAATGAAAAAGAAATGGTTATTGTTGTTTTTATGTTACTCTCAGCAGATAGTTACTACGCCGTCATAGATGATGCAATCGCACCACCACCACCAATGGAGTTACCGCGTGAGAAACCTTCCACCAAGGTCAACCCAACAATGGCGATTATACTGGTGTGCATTTTAAGTGCCTTCTTCATGATATGTGTCGTCTCCACTTACTTCCGCCATTTTACTGAACGACAACTCAGACTTGCTGG...

Protein

Download Protein FASTA

304 aa · LXL04_039123|LXL04_039123|OH1004|PROTEIN

MQLHIFSNEKEMVIVVFMLLSADSYYAVIDDAIAPPPPMELPREKPSTKVNPTMAIILVCILSAFFMICVVSTYFRHFTERQLRLAGSTQTRSETGSTRSVVHGLDPSVIATFPRFLYSSVKGIKIGQTVLECAVCLNEFQDHETLRLLPKCSHVFHQDCIDTWLVSHVTCPVCRANLVVRPGELDHVTESSLHLPVDPEIDFASTEFLLPIESKHKIPPTTEMPRSHSTGHSVVVRPVENTERYTLRLPSEARSLFGNN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_039123`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_039123

Location Chr09:59681740-59682654 (+)

Description Similar to ATL6: E3 ubiquitin-protein ligase ATL6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g05200`	E3 ubiquitin-protein ligase able to catalyze polyubiquitination with ubiquitin-conjugating enzyme E2 UBC8 in vitro.	No verified direct reference in this release
`At5g27420`	E3 ubiquitin-protein ligase that is required for the plant C/N response during seedling growth transition.	CNI1/ATL31, a RING-type ubiquitin ligase that functions in the carbon/nitrogen response for growth phase transition in Arabidopsis seedlings.2009 · DOI: 10.1111/j.1365-313x.2009.04006.x
`At1g22500`	E3 ubiquitin-protein ligase able to catalyze polyubiquitination with ubiquitin-conjugating enzyme E2 UBC8, UBC10, UBC11, UBC28 and UBC29 in vitro.	No verified direct reference in this release
`At1g72200`	RING-H2 finger protein ATL11.	No verified direct reference in this release
`At1g35330`	RING-H2 finger protein ATL34.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039123 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009416 response to light stimulus Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0033591 response to L-ascorbic acid Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0043562 cellular response to nitrogen levels Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0098542 defense response to other organism Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G22500

ath:AT1G72200

ath:AT3G05200

ath:AT5G27420

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.266

Rank 1 · LXL04_039123 · OH-1004

Endoplasmic reticulum0.250

Rank 2 · LXL04_039123 · OH-1004

Lysosome / Vacuole0.242

Rank 3 · LXL04_039123 · OH-1004

Cytoplasm0.211

Rank 4 · LXL04_039123 · OH-1004

Golgi apparatus0.170

Rank 5 · LXL04_039123 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13639.13zf-RING_2132-175 aa

PF17123.12zf-RING_11132-161 aa

PF13923.13zf-C3HC4_2132-174 aa

PF14634.13zf-RING_5132-175 aa

PF00097.32zf-C3HC4133-174 aa

PF13445.13zf-RING_UBOX133-172 aa

PF12678.14zf-rbx1135-175 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_039123	`PF13639.13`	zf-RING_2	132	175	2.2e-14	54.1
LXL04_039123	`PF17123.12`	zf-RING_11	132	161	1.2e-11	44.8
LXL04_039123	`PF13923.13`	zf-C3HC4_2	132	174	7.5e-09	36.0
LXL04_039123	`PF14634.13`	zf-RING_5	132	175	8.7e-06	26.3
LXL04_039123	`PF00097.32`	zf-C3HC4	133	174	5.1e-07	30.2
LXL04_039123	`PF13445.13`	zf-RING_UBOX	133	172	6.2e-06	26.8
LXL04_039123	`PF12678.14`	zf-rbx1	135	175	4.4e-08	33.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RXX9`	Arabidopsis thaliana	E3 ubiquitin-protein ligase ATL6	42.471%	Swiss-Prot	moderate database homology
`Q8LGA5`	Arabidopsis thaliana	E3 ubiquitin-protein ligase ATL31	40.984%	Swiss-Prot	moderate database homology
`Q9SK92`	Arabidopsis thaliana	E3 ubiquitin-protein ligase ATL15	37.786%	Swiss-Prot	moderate database homology
`Q84W40`	Arabidopsis thaliana	RING-H2 finger protein ATL11	38.321%	Swiss-Prot	moderate database homology
`Q9C7I1`	Arabidopsis thaliana	RING-H2 finger protein ATL34	37.762%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card