TkA04G498030 | RubberDandelionOmics

Gene overview

TkA04G498030

Reference: TK1151 Chr: Chr04 Coordinates: 125801507-125803633 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1306 bp · TkA04G498030|TK1151|cDNA

GTGTGTGTGTGTGTGTTTCTGTGTTTGTGTAGTTTCATAATTTCTTCATAATCAAATCAGTTAACTTCGTGTAATTCCATCTGCAAAAAGTCAATTTTGGATCCAATCCTTGGTCTTCGTCAAGTCATCTTTTCTCCCTTGTGTTGATCTACTCATGTCGTATCTGCTTTAGCAGCAATCGGCGAGAAAGAATGGTTTTTCTATGTGCCAAGAGACAAGAAGTACCGTAATGGGGATAGACCTAACCGTGTGACCACTTC...

CDS

Download CDS FASTA

1152 bp · TkA04G498030|TK1151|CDS

ATGACAATAGAAGCAAGGACCATGAACCAAGAAGAAGAGATAAGAGGCAAGAAGCAGCAAGAAGACGAGGGTGATGATGATCATGAAAACGACATGGTGATGCCAGGGTTTCGTTTTCATCCAACGGAGGAAGAGCTTGTGGAGTTCTACCTTCGCCGTAAGGTAGAGGGCAAGAAATTCAATGTTGAGCTCATCACTTTTCTTGATCTATATCGATACGATCCGTGGGAACTCCCTGCTTTAGCAGCAATCGGCGAGAA...

Protein

Download Protein FASTA

383 aa · TkA04G498030|TK1151|PROTEIN

MTIEARTMNQEEEIRGKKQQEDEGDDDHENDMVMPGFRFHPTEEELVEFYLRRKVEGKKFNVELITFLDLYRYDPWELPALAAIGEKEWFFYVPRDKKYRNGDRPNRVTTSGYWKATGADRMIKTDTASRSIGLKKTLVFYSGKAPKGIRSSWIMNEFRLPQHETERLQKAEISLCKVYKRSGVVDDHPSLPRSLQTRSTSSRASNYHNNQSSSSNFTYFEGQSSHHSSDEKLSDTVTGGSTADNIVGTALGLSNPINSS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G498030`
TK1151 ID	TkA04G498030
OH-1004 ID	LXL04_028733
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	60.700
Protein coverage (%)	TK1151 92.689 / OH-1004 91.667 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G498030

Location Chr04:125801507-125803633 (-)

Description Similar to NAC035: NAC domain-containing protein 35

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g02450`	Transcription factor that acts as a floral repressor.	Control of flowering time and cold response by a NAC-domain protein in Arabidopsis.2007 · DOI: 10.1371/journal.pone.0000642
`At5g39820`	Putative NAC domain-containing protein 94.	No verified direct reference in this release
`At1g26870`	Promotes periclinal root capforming cell divisions.	No verified direct reference in this release
`At1g34180`	Transcriptional activator activated by proteolytic cleavage through regulated intramembrane proteolysis (RIP) (By similarity).	Mutation of the Arabidopsis NAC016 transcription factor delays leaf senescence.2013 · DOI: 10.1093/pcp/pct113
`At3g15170`	Transcription activator of STM and KNAT6.	Shoot apical meristem and cotyledon formation during Arabidopsis embryogenesis: interaction among the CUP-SHAPED COTYLEDON and SHOOT MERISTEMLESS genes.1999 · DOI: 10.1242/dev.126.8.1563 Involvement of CUP-SHAPED COTYLEDON genes in gynoecium and ovule development in Arabidopsis thaliana.2000 · DOI: 10.1093/pcp/41.1.60 The CUP-SHAPED COTYLEDON1 gene of Arabidopsis regulates shoot apical meristem formation.2001 · DOI: 10.1242/dev.128.7.1127 Roles of PIN-FORMED1 and MONOPTEROS in pattern formation of the apical region of the Arabidopsis embryo.2002 · DOI: 10.1242/dev.129.17.3965 Developmental events and shoot apical meristem gene expression patterns during shoot development in Arabidopsis thaliana.2002 · DOI: 10.1046/j.1365-313x.2002.01479.x The CUP-SHAPED COTYLEDON genes promote adventitious shoot formation on calli.2003 · DOI: 10.1093/pcp/pcg038 Dominant repression of target genes by chimeric repressors that include the EAR motif, a repression domain, in Arabidopsis.2003 · DOI: 10.1046/j.1365-313x.2003.01759.x CUC1 gene activates the expression of SAM-related genes to induce adventitious shoot formation.2003 · DOI: 10.1046/j.1365-313x.2003.01911.x MicroRNA regulation of NAC-domain targets is required for proper formation and separation of adjacent embryonic, vegetative, and floral organs.2004 · DOI: 10.1016/j.cub.2004.06.022 MicroRNA regulation of the CUC genes is required for boundary size control in Arabidopsis meristems.2004 · DOI: 10.1242/dev.01320 The early extra petals1 mutant uncovers a role for microRNA miR164c in regulating petal number in Arabidopsis.2005 · DOI: 10.1016/j.cub.2005.02.017 KNAT6: an Arabidopsis homeobox gene involved in meristem activity and organ separation.2006 · DOI: 10.1105/tpc.106.041988 Arabidopsis CUP-SHAPED COTYLEDON3 regulates postembryonic shoot meristem and organ boundary formation.2006 · DOI: 10.1105/tpc.106.045716 Redundancy and specialization among plant microRNAs: role of the MIR164 family in developmental robustness.2007 · DOI: 10.1242/dev.02817 Genes involved in organ separation in Arabidopsis: an analysis of the cup-shaped cotyledon mutant.1997 · DOI: 10.1105/tpc.9.6.841

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0133000`	Transcription activator that binds sequence-specific DNA motifs.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028733 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009733 response to auxin Biological Process

GO:0009908 flower development Biological Process

GO:0045770 positive regulation of asymmetric cell division Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0048103 somatic stem cell division Biological Process

GO:0048829 root cap development Biological Process

GO:0099402 plant organ development Biological Process

GO:1901002 positive regulation of response to salt stress Biological Process

GO:1902584 positive regulation of response to water deprivation Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G26870

ath:AT2G02450

ath:AT5G39820

dosa:Os03g0133000

gmx:732555

osa:4331520

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.918

Rank 1 · TkA04G498030 · TK1151

Cytoplasm0.130

Rank 2 · TkA04G498030 · TK1151

Cell membrane0.054

Rank 3 · TkA04G498030 · TK1151

Endoplasmic reticulum0.040

Rank 4 · TkA04G498030 · TK1151

Plastid0.017

Rank 5 · TkA04G498030 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02365NAM35-160 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G498030	`PF02365`	NAM	35	160	1.6e-44	152.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZVP8`	Arabidopsis thaliana	sp\|Q9ZVP8\|NAC35_ARATH NAC domain-containing protein 35	85.000%	Swiss-Prot	Low
`Q9FIW5`	Arabidopsis thaliana	sp\|Q9FIW5\|NAC94_ARATH Putative NAC domain-containing protein 94	49.500%	Swiss-Prot	Low
`Q9ZVH0`	Arabidopsis thaliana	sp\|Q9ZVH0\|FEZ_ARATH Protein FEZ	47.500%	Swiss-Prot	Low
`A4FVP6`	Arabidopsis thaliana	sp\|A4FVP6\|NAC16_ARATH NAC domain-containing protein 16	50.900%	Swiss-Prot	Low
`Q9FRV4`	Arabidopsis thaliana	sp\|Q9FRV4\|NAC54_ARATH Protein CUP-SHAPED COTYLEDON 1	45.200%	Swiss-Prot	Low
`Q10S65`	Oryza sativa subsp. japonica	sp\|Q10S65\|NAC22_ORYSJ NAC domain-containing protein 22	55.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card