TkA04G486610 | RubberDandelionOmics

Gene overview

TkA04G486610

Reference: TK1151 Chr: Chr04 Coordinates: 122960261-122963419 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1675 bp · TkA04G486610|TK1151|cDNA

CCAACTATTTCATTTCGAAAGCAAAAACGAAGAACACGAGAATAAATGAAGCTTGCTTCTTGATTAACAAAGGTTAACTTCAATCCGAAAACCCTAACTTTTCACATATTCTTCTCTGCTGCAAGAAACCCTAAACTCACCAACTAGGCTTGACTGAGCGAGTCCTACTCGTTCTACTCAATCGAGTTTAAGAGCTGGAGTCCCGACATTATCCTCGATGGAGATAATCCAGAAGACCTCCGTTTGAGATTTGTCGTTTA...

CDS

Download CDS FASTA

1134 bp · TkA04G486610|TK1151|CDS

ATGGCGCCAACAAGAAAGTCTAGAAGTGTAAATAAACGGTATACCGACTATGTAGATGTCTCTCCCAGTAAAAATGTTGTCAACAAATCCGGAAGACAGAAGAGAAAGCTTTCTGACATGTTGGGATCTCCATGGACCGATGAAGAGGTTGAACGCTTTTATAAAGCTTATAGGAAATATGGAAAAGACTGGAAGAAGGTGGCTGTGATGGTGCGTAGCAGGAACTCTGAAATGGTTGAAGCTCTCTACACAATGAATAG...

Protein

Download Protein FASTA

377 aa · TkA04G486610|TK1151|PROTEIN

MAPTRKSRSVNKRYTDYVDVSPSKNVVNKSGRQKRKLSDMLGSPWTDEEVERFYKAYRKYGKDWKKVAVMVRSRNSEMVEALYTMNRAYLSLPEGTAPVVGFIAMVSDHYNALEGSDNDHEGNDIPKPVQKPKKRSHGGEEQLPPRLVGSSDKNLPQLKRRASDDETSALDGLQMLADLSFMIQSSKVDSDNMFKVVDERPVPVPEPEPEPEPEPEPEPEPEPEPEPAPAPAPEPEPEPEPEPAHEPEPEPEPEPEPEPE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G486610`
TK1151 ID	TkA04G486610
OH-1004 ID	LXL04_038943
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	95.700
Protein coverage (%)	TK1151 43.501 / OH-1004 15.861 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G486610

Location Chr04:122960261-122963419 (-)

Description Similar to ALY3: Protein ALWAYS EARLY 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g05380`	Protein ALWAYS EARLY 2.	No verified direct reference in this release
`At5g27610`	Protein ALWAYS EARLY 1.	No verified direct reference in this release
`At3g21430`	Protein ALWAYS EARLY 3.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038943 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0051726 regulation of cell cycle Biological Process

GO:0071897 DNA biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0017053 transcription repressor complex Cellular Component

GO:0070176 DRM complex Cellular Component

GO:0003677 DNA binding Molecular Function

KEGG gene cross-reference

ath:AT3G05380

ath:AT3G21430

ath:AT5G27610

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.941

Rank 1 · TkA04G486610 · TK1151

Cytoplasm0.127

Rank 2 · TkA04G486610 · TK1151

Cell membrane0.030

Rank 3 · TkA04G486610 · TK1151

Endoplasmic reticulum0.016

Rank 4 · TkA04G486610 · TK1151

Mitochondrion0.012

Rank 5 · TkA04G486610 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13921Myb_DNA-bind_65-24 aa

PF00249Myb_DNA-binding44-79 aa

PF15963Myb_DNA-bind_744-83 aa

PF13921Myb_DNA-bind_645-78 aa

PF05887Trypan_PARP114-135 aa

PF05887Trypan_PARP204-257 aa

PF05887Trypan_PARP231-285 aa

PF15963Myb_DNA-bind_7351-368 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G486610	`PF13921`	Myb_DNA-bind_6	5	24	0.0008	20.3
TkA04G486610	`PF00249`	Myb_DNA-binding	44	79	6.1e-09	36.6
TkA04G486610	`PF15963`	Myb_DNA-bind_7	44	83	0.0002	21.8
TkA04G486610	`PF13921`	Myb_DNA-bind_6	45	78	0.0008	20.3
TkA04G486610	`PF05887`	Trypan_PARP	114	135	2.8e-08	34.5
TkA04G486610	`PF05887`	Trypan_PARP	204	257	2.8e-08	34.5
TkA04G486610	`PF05887`	Trypan_PARP	231	285	2.8e-08	34.5
TkA04G486610	`PF15963`	Myb_DNA-bind_7	351	368	0.0002	21.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6A333`	Arabidopsis thaliana	sp\|Q6A333\|ALY2_ARATH Protein ALWAYS EARLY 2	51.500%	Swiss-Prot	High
`Q6A331`	Arabidopsis thaliana	sp\|Q6A331\|ALY1_ARATH Protein ALWAYS EARLY 1	50.000%	Swiss-Prot	High
`Q6A332`	Arabidopsis thaliana	sp\|Q6A332\|ALY3_ARATH Protein ALWAYS EARLY 3	48.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card