TkA04G470090 | RubberDandelionOmics

Gene overview

TkA04G470090

Reference: TK1151 Chr: Chr04 Coordinates: 118714703-118715893 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1191 bp · TkA04G470090|TK1151|cDNA

ATGTTGGAAGAGATGATTGATGCAAGCTATTACATTCCACCGGAGCTCGTAACCGACATATTCTTGAGATTACCAGTCAAAACGCTAATTCGATGCACCTCTGTTTGTAAGTCATGGTACGCTCTTATCAGAAACCCTAATTTCGTCGATTTACATTTCAATTCCAATGGCAATTATCGTCCGGAGTGTCTCGATAATGGATATATACTATTAGGCGGCACTAATTTCTGCCATGTAGTTTGTGATAAAGAATTCAAATC...

CDS

Download CDS FASTA

1191 bp · TkA04G470090|TK1151|CDS

ATGTTGGAAGAGATGATTGATGCAAGCTATTACATTCCACCGGAGCTCGTAACCGACATATTCTTGAGATTACCAGTCAAAACGCTAATTCGATGCACCTCTGTTTGTAAGTCATGGTACGCTCTTATCAGAAACCCTAATTTCGTCGATTTACATTTCAATTCCAATGGCAATTATCGTCCGGAGTGTCTCGATAATGGATATATACTATTAGGCGGCACTAATTTCTGCCATGTAGTTTGTGATAAAGAATTCAAATC...

Protein

Download Protein FASTA

396 aa · TkA04G470090|TK1151|PROTEIN

MLEEMIDASYYIPPELVTDIFLRLPVKTLIRCTSVCKSWYALIRNPNFVDLHFNSNGNYRPECLDNGYILLGGTNFCHVVCDKEFKSLYAVQTPFAVGRNRKSSLNFVGSCNGLLCLAPGLEYNLGNDVYIWNPSTRTHKKLPPSQFSDEFIDERWMVSRLGFGFHESTNDYKVIRLIYFPECRNFTSVDVAPLVEVYSLETDSWRIIRTEVPPIVTQSVVTFHNGVFYWMGFKSIRDDPMENYIMSFDLDNEKFKEIEQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G470090`
TK1151 ID	TkA04G470090
OH-1004 ID	LXL04_038839
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.400
Protein coverage (%)	TK1151 83.333 / OH-1004 87.766 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G470090

Location Chr04:118714703-118715893 (-)

Description Similar to CPR1: F-box protein CPR1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g12560`	Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins (By similarity).	An F-box gene, CPR30, functions as a negative regulator of the defense response in Arabidopsis.2009 · DOI: 10.1111/j.1365-313x.2009.03995.x
`At3g07870`	F-box protein At3g07870.	No verified direct reference in this release
`At3g06240`	F-box/kelch-repeat protein At3g06240.	No verified direct reference in this release
`At3g23880`	F-box/kelch-repeat protein At3g23880.	No verified direct reference in this release
`At2g43440`	F-box protein At2g43440.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038839 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0008284 positive regulation of cell population proliferation Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0031348 negative regulation of defense response Biological Process

GO:0042177 negative regulation of protein catabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009506 plasmodesma Cellular Component

KEGG gene cross-reference

ath:AT1G11620

ath:AT3G06240

ath:AT3G07870

ath:AT4G12560

ath:AT4G38870

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.616

Rank 1 · TkA04G470090 · TK1151

Nucleus0.371

Rank 2 · TkA04G470090 · TK1151

Endoplasmic reticulum0.100

Rank 3 · TkA04G470090 · TK1151

Cell membrane0.085

Rank 4 · TkA04G470090 · TK1151

Mitochondrion0.050

Rank 5 · TkA04G470090 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box12-48 aa

PF12937F-box-like12-46 aa

PF03478Beta-prop_KIB1-488-282 aa

PF07734FBA_1100-314 aa

PF08268FBA_3101-311 aa

PF01344Kelch_1127-144 aa

PF01344Kelch_1195-208 aa

PF01344Kelch_1244-257 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G470090	`PF00646`	F-box	12	48	1e-09	38.6
TkA04G470090	`PF12937`	F-box-like	12	46	2.6e-09	37.4
TkA04G470090	`PF03478`	Beta-prop_KIB1-4	88	282	1.1e-06	29.0
TkA04G470090	`PF07734`	FBA_1	100	314	2e-20	73.8
TkA04G470090	`PF08268`	FBA_3	101	311	2.1e-20	73.7
TkA04G470090	`PF01344`	Kelch_1	127	144	0.00035	20.7
TkA04G470090	`PF01344`	Kelch_1	195	208	0.00035	20.7
TkA04G470090	`PF01344`	Kelch_1	244	257	0.00035	20.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SU30`	Arabidopsis thaliana	sp\|Q9SU30\|CPR1_ARATH F-box protein CPR1	28.600%	Swiss-Prot	Low
`Q9SFC7`	Arabidopsis thaliana	sp\|Q9SFC7\|FB135_ARATH F-box protein At3g07870	26.800%	Swiss-Prot	Low
`Q8GXC7`	Arabidopsis thaliana	sp\|Q8GXC7\|FBK50_ARATH F-box/kelch-repeat protein At3g06240	27.700%	Swiss-Prot	Low
`Q9LIR8`	Arabidopsis thaliana	sp\|Q9LIR8\|FBK67_ARATH F-box/kelch-repeat protein At3g23880	26.300%	Swiss-Prot	Low
`A8MS20`	Arabidopsis thaliana	sp\|A8MS20\|FB350_ARATH F-box protein At2g43440	23.700%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card