TkA04G407800 | RubberDandelionOmics

Gene overview

TkA04G407800

Reference: TK1151 Chr: Chr04 Coordinates: 102512388-102516534 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2377 bp · TkA04G407800|TK1151|cDNA

CGAGAGTCTACAAAAGAAAAACAATTGCTAGGGGTCGAGGTATATGTATGTGTGTAACATTTAAGTTATGTATATATATTTTAAAGGATGATGTCGTAATTTTAATATTTTGTTCTATCATATTCTAGTTTTAGTGTTTTACCAAACATTATATAATTCGTGTGGTCGAATCCAATTTTGTTGAATCCAGTTATGTCATGTCACCAAACGCTATCTAAGTTAAATAAACTCGAGAAAAGGGTGTTATATGTAGCAAGTGA...

CDS

Download CDS FASTA

1317 bp · TkA04G407800|TK1151|CDS

ATGGGATCTGCATGTTGTGTGGCTGCTAGAGATAGAACCATAACAGATCGATCTGGAAGTAGTGATGTTGTTGTTAGAAATGATAGGTATTCGCCTTCATGGAGCTTTAGATGGGATAACAGAGGGCGTGTAGCAGGTGAAGAATCCTCCATGAATGGTTTCTCTCATGGAGTTGTTACAAATGATAGATTATTGGACAATAAATCTCATGCCACAGAAGAAGGCAGTCCATTGGACAGTTCAAGAAGTCTCACATGGCA...

Protein

Download Protein FASTA

438 aa · TkA04G407800|TK1151|PROTEIN

MGSACCVAARDRTITDRSGSSDVVVRNDRYSPSWSFRWDNRGRVAGEESSMNGFSHGVVTNDRLLDNKSHATEEGSPLDSSRSLTWQKSSPSEEIRFHQSDPLNSKNLPAGKESMETPVTLDLSPTKTSTSSLSASPLSSSQGHLPPLSTLTPSRWPRHHHHHNHLRQVSDSRIRGIMSPNFSISEEASPSPSSFIHPGWAPHHHHNKSTRGGSSDLSSDPTTYSDLMAIYNHNNNSNNSNNSKRWSFDSESLSFSRERG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G407800`
TK1151 ID	TkA04G407800
OH-1004 ID	LXL04_001737
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	47.000
Protein coverage (%)	TK1151 98.630 / OH-1004 55.689 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G407800`
Location	Chr04:102512388-102516534 (-)
Description	Similar to UBP21: Ubiquitin carboxyl-terminal hydrolase 21
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_001737` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006281 DNA repair Biological Process GO:0006508 proteolysis Biological Process GO:0007283 spermatogenesis Biological Process GO:0016579 protein deubiquitination Biological Process GO:0030154 cell differentiation Biological Process GO:0031647 regulation of protein stability Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0004843 cysteine-type deubiquitinase activity Molecular Function
KEGG gene cross-reference	ath:AT4G17895 ath:AT5G46740 hsa:84132 mmu:76800 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.454

Rank 1 · TkA04G407800 · TK1151

Nucleus0.370

Rank 2 · TkA04G407800 · TK1151

Cytoplasm0.336

Rank 3 · TkA04G407800 · TK1151

Endoplasmic reticulum0.062

Rank 4 · TkA04G407800 · TK1151

Plastid0.035

Rank 5 · TkA04G407800 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17120zf-RING_16286-291 aa

PF12678zf-rbx1287-352 aa

PF13639zf-RING_2287-293 aa

PF14634zf-RING_5287-298 aa

PF13923zf-C3HC4_2287-296 aa

PF15227zf-C3HC4_4287-295 aa

PF13445zf-RING_UBOX318-350 aa

PF23555zf-RING_Vps41321-337 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G407800	`PF17120`	zf-RING_16	286	291	0.18	12.1
TkA04G407800	`PF12678`	zf-rbx1	287	352	0.00059	20.7
TkA04G407800	`PF13639`	zf-RING_2	287	293	0.00075	20.4
TkA04G407800	`PF14634`	zf-RING_5	287	298	0.0011	19.6
TkA04G407800	`PF13923`	zf-C3HC4_2	287	296	0.13	12.8
TkA04G407800	`PF15227`	zf-C3HC4_4	287	295	0.25	12.2
TkA04G407800	`PF13445`	zf-RING_UBOX	318	350	0.0019	18.9
TkA04G407800	`PF23555`	zf-RING_Vps41	321	337	0.00039	20.7
TkA04G407800	`PF23412`	zf_RING_Vps8	321	337	0.00049	20.6
TkA04G407800	`PF17123`	zf-RING_11	321	335	0.029	14.8
TkA04G407800	`PF13639`	zf-RING_2	322	352	0.00075	20.4
TkA04G407800	`PF17120`	zf-RING_16	322	338	0.18	12.1
TkA04G407800	`PF23413`	zf_RING_Vps8_fungal	323	352	9.1e-06	25.6
TkA04G407800	`PF14634`	zf-RING_5	323	352	0.0011	19.6
TkA04G407800	`PF00097`	zf-C3HC4	323	352	0.011	16.2
TkA04G407800	`PF13923`	zf-C3HC4_2	323	352	0.13	12.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card