TkA04G399270 | RubberDandelionOmics

Gene overview

TkA04G399270

Reference: TK1151 Chr: Chr04 Coordinates: 100429615-100433899 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2516 bp · TkA04G399270|TK1151|cDNA

ACCCAATAATAATAAAACTACATTATTTTATGATAAAAGACTGGGAGTTACAGGTTTACCCTTCGACACTTCAGTGTAGATCGCTCACCGTATTTTCCAAAATTCAAATTCGAGAGAGGGAAAACTCAGCCCGCTCAACTGCGTTTCTTCTACTCCCAAAATCACAATCGTTCTTGATTTCAGGAAATCCAAAAATTTCTGTAACCTGTTGCAGAACATCAATAATTCTCTAACATACTAACTTCAATTCTGTGTATTCT...

CDS

Download CDS FASTA

2019 bp · TkA04G399270|TK1151|CDS

ATGGAGGAAACCCTAAGCCCTAGCCGTACACCGGGACACAAACAAAGAGCGCCGGTCCTCTCTCCGGATCGACCTTTATTTTTGGGCTCTAACGACGATAAGCTCGAACGTGCTCAAGCACGCGCCGCTCGTGCTGCAGCTATCCGCCGGAAGCCTGTGGCATTGCATCAAGCAACCGATGCTAATCTTGCCGACCCATGTCTTGGCCAAGAGCAGATTATGGAACTGTTTCAAAATTGCATCAAACTAGCCAGTGAGAA...

Protein

Download Protein FASTA

672 aa · TkA04G399270|TK1151|PROTEIN

MEETLSPSRTPGHKQRAPVLSPDRPLFLGSNDDKLERAQARAARAAAIRRKPVALHQATDANLADPCLGQEQIMELFQNCIKLASENKINQKNTWELNLIDHLCDIIKVEEENDVETNFQKASCTLEAGVRIYSMRVDSVHSEAYKVLGGISRVALDAEQDTVDDNNTDNMPGERTSKKEKELKLSPLSTLESSFEALNVKKFDVAFAVDPLYHQTTAQFDEGGSKGLLLNNLGVYGGCRMIFDSLEVPSKCMSSSNEHK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G399270`
TK1151 ID	TkA04G399270
OH-1004 ID	LXL04_038152
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G399270

Location Chr04:100429615-100433899 (+)

Description Similar to CAPH: Condensin complex subunit 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g32590`	Regulatory subunit of the condensin complex, a complex required for conversion of interphase chromatin into mitotic-like condense chromosomes.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038152 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006281 DNA repair Biological Process

GO:0007076 mitotic chromosome condensation Biological Process

GO:0007143 female meiotic nuclear division Biological Process

GO:0010032 meiotic chromosome condensation Biological Process

GO:0045132 meiotic chromosome segregation Biological Process

GO:0048468 cell development Biological Process

GO:0051301 cell division Biological Process

GO:0051309 female meiosis chromosome separation Biological Process

GO:0051315 attachment of mitotic spindle microtubules to kinetochore Biological Process

GO:0051984 positive regulation of chromosome segregation Biological Process

GO:1905820 positive regulation of chromosome separation Biological Process

GO:1905821 positive regulation of chromosome condensation Biological Process

KEGG gene cross-reference

ath:AT2G32590

hsa:23397

mmu:215387

spo:2538744

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.939

Rank 1 · TkA04G399270 · TK1151

Cytoplasm0.200

Rank 2 · TkA04G399270 · TK1151

Mitochondrion0.023

Rank 3 · TkA04G399270 · TK1151

Cell membrane0.016

Rank 4 · TkA04G399270 · TK1151

Golgi apparatus0.008

Rank 5 · TkA04G399270 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05786Cnd224-525 aa

PF06278CNDH2_N87-174 aa

PF05786Cnd2528-668 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G399270	`PF05786`	Cnd2	24	525	2e-113	381.3
TkA04G399270	`PF06278`	CNDH2_N	87	174	0.00021	22.1
TkA04G399270	`PF05786`	Cnd2	528	668	2e-113	381.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q564K3`	Arabidopsis thaliana	sp\|Q564K3\|CND2_ARATH Condensin complex subunit 2	55.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card