LXL04_038152 | RubberDandelionOmics

Gene overview

LXL04_038152

Reference: OH-1004 Chr: Chr09 Coordinates: 32368396-32371993 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2019 bp · LXL04_038152|LXL04_038152|OH1004|cDNA

ATGGAGGAAACCCTAAGCCCTAGCCGTACACCGGGACACAAACAAAGAGCGCCGGTCCTCTCTCCGGATCGACCTTTATTTTTGGGCTCTAACGACGATAAGCTCGAACGTGCTCAAGCACGCGCCGCTCGTGCTGCAGCTATCCGCCGGAAGCCTGTGGCATTGCATCAAGCAACCGATGCTAATCTTGCCGACCCATGTCTTGGCCAAGAGCAGATTATGGAACTGTTTCAAAATTGCATCAAACTAGCCAGTGAGAA...

CDS

Download CDS FASTA

2019 bp · LXL04_038152|LXL04_038152|OH1004|CDS

ATGGAGGAAACCCTAAGCCCTAGCCGTACACCGGGACACAAACAAAGAGCGCCGGTCCTCTCTCCGGATCGACCTTTATTTTTGGGCTCTAACGACGATAAGCTCGAACGTGCTCAAGCACGCGCCGCTCGTGCTGCAGCTATCCGCCGGAAGCCTGTGGCATTGCATCAAGCAACCGATGCTAATCTTGCCGACCCATGTCTTGGCCAAGAGCAGATTATGGAACTGTTTCAAAATTGCATCAAACTAGCCAGTGAGAA...

Protein

Download Protein FASTA

672 aa · LXL04_038152|LXL04_038152|OH1004|PROTEIN

MEETLSPSRTPGHKQRAPVLSPDRPLFLGSNDDKLERAQARAARAAAIRRKPVALHQATDANLADPCLGQEQIMELFQNCIKLASENKINQKNTWELNLIDHLCDIIKVEEENDVETNFQKASCTLEAGVRIYSMRVDSVHSEAYKVLGGISRVALDAEQDTVDDNNTDNMPGERTSKKEKELKLSPLSTLESSFEALNVKKFDVAFAVDPLYHQTTAQFDEGGSKGLLLNNLGVYGGCRMIFDSLEVPSKCMSSSNEHK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_038152`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_038152

Location Chr09:32368396-32371993 (+)

Description Similar to CAPH: Condensin complex subunit 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g32590`	Regulatory subunit of the condensin complex, a complex required for conversion of interphase chromatin into mitotic-like condense chromosomes.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038152 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006281 DNA repair Biological Process

GO:0007076 mitotic chromosome condensation Biological Process

GO:0007143 female meiotic nuclear division Biological Process

GO:0010032 meiotic chromosome condensation Biological Process

GO:0045132 meiotic chromosome segregation Biological Process

GO:0048468 cell development Biological Process

GO:0051301 cell division Biological Process

GO:0051309 female meiosis chromosome separation Biological Process

GO:0051315 attachment of mitotic spindle microtubules to kinetochore Biological Process

GO:0051984 positive regulation of chromosome segregation Biological Process

GO:1905820 positive regulation of chromosome separation Biological Process

GO:1905821 positive regulation of chromosome condensation Biological Process

KEGG gene cross-reference

ath:AT2G32590

hsa:23397

mmu:215387

spo:2538744

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.940

Rank 1 · LXL04_038152 · OH-1004

Cytoplasm0.199

Rank 2 · LXL04_038152 · OH-1004

Mitochondrion0.023

Rank 3 · LXL04_038152 · OH-1004

Cell membrane0.016

Rank 4 · LXL04_038152 · OH-1004

Golgi apparatus0.008

Rank 5 · LXL04_038152 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05786.20Cnd224-523 aa

PF05786.20Cnd2528-668 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_038152	`PF05786.20`	Cnd2	24	523	3.1e-113	380.7
LXL04_038152	`PF05786.20`	Cnd2	528	668	3.1e-113	380.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q564K3`	Arabidopsis thaliana	Condensin complex subunit 2	55.844%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card