TkA04G309220 | RubberDandelionOmics

Gene overview

TkA04G309220

Reference: TK1151 Chr: Chr04 Coordinates: 78012156-78014984 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1599 bp · TkA04G309220|TK1151|cDNA

ATAAATTAGAGAAGAAAGGGAAATAAAGCCACTTCAATTTCTCCCTCAAAACTCAAACACACTCTAAGGTTTTAACCGCCATGCCAATTTCCGGCACACCTCCACCGCCGGTACTTCGATAAATACTCTCGAACGGGAGGAGCTACGATTGCGTCGTTAACAATCTCAAATATCCGATCAAAAACCATGTGTAGCAAATCAAAGAGGCTGACCATGGGCAAAGACAGAGGCCATAAGCAACAAGAAATTGATATCAGCAA...

CDS

Download CDS FASTA

1377 bp · TkA04G309220|TK1151|CDS

ATGTGTAGCAAATCAAAGAGGCTGACCATGGGCAAAGACAGAGGCCATAAGCAACAAGAAATTGATATCAGCAATCTACCTGATTGTATCCTTCATCATATTCTGTCATTGATGCCCACAAAAGAAGCTGTAAAGACGTCCATATTATCTACAAGATGGAAGAACCTCTGGGCTTTTCTTCCCACCATTGTTCTTGATGATGGATTGTTGATGGCTAAAAAGGTTGAAGATGCAACTTCCTTTGTGAACTTTGTAGAAAG...

Protein

Download Protein FASTA

458 aa · TkA04G309220|TK1151|PROTEIN

MCSKSKRLTMGKDRGHKQQEIDISNLPDCILHHILSLMPTKEAVKTSILSTRWKNLWAFLPTIVLDDGLLMAKKVEDATSFVNFVERVLHLRGASNMEKLNLSCRVFQDSLKIRSWISDAIMHNVQELDLSLFANNPSMIPKSIFDNTSLVSLKIRMNCAIELPSHVSFPCLKTLHLFFVWFQNDDFTEKLFSGCPVLEELVLFKNCFKNLKNFVITSSILKSLNIRDQIYFRVFEDVSGCKIKIDAPNLTYFEYLGYLS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G309220`
TK1151 ID	TkA04G309220
OH-1004 ID	LXL04_039779
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	98.900
Protein coverage (%)	TK1151 100.000 / OH-1004 81.640 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G309220

Location Chr04:78012156-78014984 (-)

Description Similar to At3g59240: Putative F-box/FBD/LRR-repeat protein At3g59240

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g59240`	Putative F-box/FBD/LRR-repeat protein At3g59240.	No verified direct reference in this release
`At4g22280`	F-box protein At4g22280.	No verified direct reference in this release
`At3g58860`	Putative F-box protein At3g58860.	No verified direct reference in this release
`At4g14096`	F-box/LRR-repeat protein At4g14096.	No verified direct reference in this release
`At3g59210`	F-box/LRR-repeat protein At3g59210.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039779 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference

ath:AT3G58860

ath:AT3G59240

ath:AT4G22280

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.882

Rank 1 · TkA04G309220 · TK1151

Cytoplasm0.176

Rank 2 · TkA04G309220 · TK1151

Cell membrane0.030

Rank 3 · TkA04G309220 · TK1151

Endoplasmic reticulum0.027

Rank 4 · TkA04G309220 · TK1151

Plastid0.013

Rank 5 · TkA04G309220 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box23-58 aa

PF12937F-box-like23-56 aa

PF08387FBD24-34 aa

PF23622LRR_At1g61320_AtMIF133-65 aa

PF23622LRR_At1g61320_AtMIF199-424 aa

PF24758LRR_At5g56370114-233 aa

PF07723LRR_2171-196 aa

PF07723LRR_2199-210 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G309220	`PF00646`	F-box	23	58	3.9e-09	36.8
TkA04G309220	`PF12937`	F-box-like	23	56	0.011	16.2
TkA04G309220	`PF08387`	FBD	24	34	9.6e-10	38.9
TkA04G309220	`PF23622`	LRR_At1g61320_AtMIF1	33	65	8e-15	55.8
TkA04G309220	`PF23622`	LRR_At1g61320_AtMIF1	99	424	8e-15	55.8
TkA04G309220	`PF24758`	LRR_At5g56370	114	233	1.2e-18	68.3
TkA04G309220	`PF07723`	LRR_2	171	196	3.1e-08	34.6
TkA04G309220	`PF07723`	LRR_2	199	210	3.1e-08	34.6
TkA04G309220	`PF00646`	F-box	218	233	3.9e-09	36.8
TkA04G309220	`PF24758`	LRR_At5g56370	304	365	1.2e-18	68.3
TkA04G309220	`PF08387`	FBD	344	360	9.6e-10	38.9
TkA04G309220	`PF07723`	LRR_2	350	355	3.1e-08	34.6
TkA04G309220	`PF08387`	FBD	380	422	9.6e-10	38.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LX47`	Arabidopsis thaliana	sp\|Q9LX47\|FDL46_ARATH Putative F-box/FBD/LRR-repeat protein At3g59240	35.100%	Swiss-Prot	Medium
`Q3E7K7`	Arabidopsis thaliana	sp\|Q3E7K7\|FB243_ARATH F-box protein At4g22280	30.400%	Swiss-Prot	Medium
`Q9LXR6`	Arabidopsis thaliana	sp\|Q9LXR6\|FB207_ARATH Putative F-box protein At3g58860	29.200%	Swiss-Prot	Low
`Q94B46`	Arabidopsis thaliana	sp\|Q94B46\|FBL74_ARATH F-box/LRR-repeat protein At4g14096	31.200%	Swiss-Prot	Medium
`Q8GW80`	Arabidopsis thaliana	sp\|Q8GW80\|FBL65_ARATH F-box/LRR-repeat protein At3g59210	31.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card