LXL04_039779 | RubberDandelionOmics

Gene overview

LXL04_039779

Reference: OH-1004 Chr: JAJTUU010000040.1 Coordinates: 80331-85464 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1686 bp · LXL04_039779|LXL04_039779|OH1004|cDNA

ATGTGTAGCAAATCAAAGAGGCTGACCATGGGCAAAGACAGAGGCCATAAGCAACAAGAAATTGATATCAGCAATCTACCTGATTGTATCCTTCATCATATTCTGTCATTGATGCCCACAAAAGAAGCTGTAAAGACGTCCATATTATCTACAAGATGGAAGAACCTCTGGGCTTTTCTTCCCACCATTGTTCTTGATGATGGATTGTTGATGGCTAAAAAGGTTGAAGATGCAACTTCCTTTGTGAACTTTGTAGAAAG...

CDS

Download CDS FASTA

1686 bp · LXL04_039779|LXL04_039779|OH1004|CDS

ATGTGTAGCAAATCAAAGAGGCTGACCATGGGCAAAGACAGAGGCCATAAGCAACAAGAAATTGATATCAGCAATCTACCTGATTGTATCCTTCATCATATTCTGTCATTGATGCCCACAAAAGAAGCTGTAAAGACGTCCATATTATCTACAAGATGGAAGAACCTCTGGGCTTTTCTTCCCACCATTGTTCTTGATGATGGATTGTTGATGGCTAAAAAGGTTGAAGATGCAACTTCCTTTGTGAACTTTGTAGAAAG...

Protein

Download Protein FASTA

561 aa · LXL04_039779|LXL04_039779|OH1004|PROTEIN

MCSKSKRLTMGKDRGHKQQEIDISNLPDCILHHILSLMPTKEAVKTSILSTRWKNLWAFLPTIVLDDGLLMAKKVEDATSFVNFVERVLHLRGASNMEKLNLSCRVFQDALKIRSWISDAIMHNVQELDLSLFANNPSMIPKSIFDNTSLVSLKIRMNCAIELPSHVSFPCLKTLHLFFVWFQNDDFTEKLFSGCPVLEELVLFKNCFKNLKNFVITSSILKSLNIRDQTYFRVFEDVSGCKIKIDAPNLTYFEYLGYLS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_039779`
TK1151 ID	TkA04G309220
OH-1004 ID	LXL04_039779
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	98.900
Protein coverage (%)	TK1151 100.000 / OH-1004 81.640 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_039779

Location JAJTUU010000040.1:80331-85464 (+)

Description Similar to At3g59240: Putative F-box/FBD/LRR-repeat protein At3g59240

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g59240`	Putative F-box/FBD/LRR-repeat protein At3g59240.	No verified direct reference in this release
`At3g58860`	Putative F-box protein At3g58860.	No verified direct reference in this release
`At4g22280`	F-box protein At4g22280.	No verified direct reference in this release
`At3g59190`	F-box/LRR-repeat protein At3g59190.	No verified direct reference in this release
`At5g22730`	FBD-associated F-box protein At5g22730.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039779 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference

ath:AT3G58860

ath:AT3G59240

ath:AT4G22280

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.747

Rank 1 · LXL04_039779 · OH-1004

Cytoplasm0.325

Rank 2 · LXL04_039779 · OH-1004

Cell membrane0.042

Rank 3 · LXL04_039779 · OH-1004

Endoplasmic reticulum0.037

Rank 4 · LXL04_039779 · OH-1004

Mitochondrion0.020

Rank 5 · LXL04_039779 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646.39F-box23-58 aa

PF24758.2LRR_At5g56370114-233 aa

PF07723.20LRR_2171-196 aa

PF08387.16FBD380-422 aa

PF00646.39F-box488-520 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_039779	`PF00646.39`	F-box	23	58	1.1e-17	63.8
LXL04_039779	`PF24758.2`	LRR_At5g56370	114	233	2.5e-18	67.3
LXL04_039779	`PF07723.20`	LRR_2	171	196	5.5e-08	33.8
LXL04_039779	`PF08387.16`	FBD	380	422	3.5e-07	30.7
LXL04_039779	`PF00646.39`	F-box	488	520	1.1e-17	63.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LX47`	Arabidopsis thaliana	Putative F-box/FBD/LRR-repeat protein At3g59240	34.521%	Swiss-Prot	moderate database homology
`Q9LXR6`	Arabidopsis thaliana	Putative F-box protein At3g58860	28.916%	Swiss-Prot	weak database homology
`Q3E7K7`	Arabidopsis thaliana	F-box protein At4g22280	30.409%	Swiss-Prot	moderate database homology
`Q1PED9`	Arabidopsis thaliana	F-box/LRR-repeat protein At3g59190	29.396%	Swiss-Prot	weak database homology
`Q9FNI8`	Arabidopsis thaliana	FBD-associated F-box protein At5g22730	28.469%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card