TkA04G308930 | RubberDandelionOmics

Gene overview

TkA04G308930

Reference: TK1151 Chr: Chr04 Coordinates: 77926307-77928008 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1125 bp · TkA04G308930|TK1151|cDNA

ATGAGTGAACACACAAGCCATGAGCAACATGAAGTTGGAGATATAATTGAAAATTTGGTCGATCATATCAGTAATCTACCTGATTCTATTCTTCATTACATTTTGTCGTTTATGCCCACAAAAGAAGCTGTAAAGACGTCCATATTATCTACAAGATGGAAGAACAAAAACCTCTGGGCCTCTACTTCCAAAATTGATTTTAATGACGGTTCGCATCAACCTGACGTCACTTCCTTCGTCAATTTAGTAGAAAGATTCTT...

CDS

Download CDS FASTA

1125 bp · TkA04G308930|TK1151|CDS

ATGAGTGAACACACAAGCCATGAGCAACATGAAGTTGGAGATATAATTGAAAATTTGGTCGATCATATCAGTAATCTACCTGATTCTATTCTTCATTACATTTTGTCGTTTATGCCCACAAAAGAAGCTGTAAAGACGTCCATATTATCTACAAGATGGAAGAACAAAAACCTCTGGGCCTCTACTTCCAAAATTGATTTTAATGACGGTTCGCATCAACCTGACGTCACTTCCTTCGTCAATTTAGTAGAAAGATTCTT...

Protein

Download Protein FASTA

374 aa · TkA04G308930|TK1151|PROTEIN

MSEHTSHEQHEVGDIIENLVDHISNLPDSILHYILSFMPTKEAVKTSILSTRWKNKNLWASTSKIDFNDGSHQPDVTSFVNLVERFFQLRNALNLEKFHLTCDGYYHESRLYSWISNAIMHNVQELDLALDNVDRSMNPWSILNKTSLVTLKIRMTSFIKLPSRFSFPCLKTFHLASIRFLNCDYSEEPFSGCPVLEELVLLDCKWMKSKYIEISSSTLKSLTLKRDTYISNKILFNNVSSLLKACIHIPSPHTCQNEVA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G308930`
TK1151 ID	TkA04G308930
OH-1004 ID	LXL04_037443
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 99.198 / OH-1004 66.369 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G308930

Location Chr04:77926307-77928008 (-)

Description Similar to At3g59200: F-box/LRR-repeat protein At3g59200

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g59240`	Putative F-box/FBD/LRR-repeat protein At3g59240.	No verified direct reference in this release
`At3g59200`	F-box/LRR-repeat protein At3g59200.	No verified direct reference in this release
`At5g53640`	Putative FBD-associated F-box protein At5g53640.	No verified direct reference in this release
`At4g14096`	F-box/LRR-repeat protein At4g14096.	No verified direct reference in this release
`At1g51370`	F-box/FBD/LRR-repeat protein At1g51370.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037443 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G16930

ath:AT3G59200

ath:AT3G59240

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.812

Rank 1 · TkA04G308930 · TK1151

Cytoplasm0.292

Rank 2 · TkA04G308930 · TK1151

Cell membrane0.031

Rank 3 · TkA04G308930 · TK1151

Endoplasmic reticulum0.029

Rank 4 · TkA04G308930 · TK1151

Mitochondrion0.017

Rank 5 · TkA04G308930 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box23-55 aa

PF12937F-box-like23-54 aa

PF08387FBD89-98 aa

PF23622LRR_At1g61320_AtMIF193-223 aa

PF18375CDH1_2_SANT_HL1158-206 aa

PF07723LRR_2169-194 aa

PF08387FBD211-224 aa

PF07723LRR_2219-237 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G308930	`PF00646`	F-box	23	55	7.2e-09	35.9
TkA04G308930	`PF12937`	F-box-like	23	54	0.0036	17.7
TkA04G308930	`PF08387`	FBD	89	98	2.1e-06	28.2
TkA04G308930	`PF23622`	LRR_At1g61320_AtMIF1	93	223	4.1e-06	27.2
TkA04G308930	`PF18375`	CDH1_2_SANT_HL1	158	206	0.0032	18.8
TkA04G308930	`PF07723`	LRR_2	169	194	0.18	13.2
TkA04G308930	`PF08387`	FBD	211	224	2.1e-06	28.2
TkA04G308930	`PF07723`	LRR_2	219	237	0.18	13.2
TkA04G308930	`PF00646`	F-box	258	279	7.2e-09	35.9
TkA04G308930	`PF00646`	F-box	299	317	7.2e-09	35.9
TkA04G308930	`PF23622`	LRR_At1g61320_AtMIF1	300	343	4.1e-06	27.2
TkA04G308930	`PF08387`	FBD	301	342	2.1e-06	28.2
TkA04G308930	`PF07723`	LRR_2	309	317	0.18	13.2
TkA04G308930	`PF18375`	CDH1_2_SANT_HL1	326	370	0.0032	18.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LX47`	Arabidopsis thaliana	sp\|Q9LX47\|FDL46_ARATH Putative F-box/FBD/LRR-repeat protein At3g59240	29.500%	Swiss-Prot	Low
`Q9LX51`	Arabidopsis thaliana	sp\|Q9LX51\|FBL64_ARATH F-box/LRR-repeat protein At3g59200	35.700%	Swiss-Prot	Medium
`Q9FJC0`	Arabidopsis thaliana	sp\|Q9FJC0\|FBD20_ARATH Putative FBD-associated F-box protein At5g53640	33.500%	Swiss-Prot	Medium
`Q94B46`	Arabidopsis thaliana	sp\|Q94B46\|FBL74_ARATH F-box/LRR-repeat protein At4g14096	26.900%	Swiss-Prot	Low
`Q6DBN6`	Arabidopsis thaliana	sp\|Q6DBN6\|FDL6_ARATH F-box/FBD/LRR-repeat protein At1g51370	33.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card