LXL04_037443 | RubberDandelionOmics

Gene overview

LXL04_037443

Reference: OH-1004 Chr: Chr09 Coordinates: 11235369-11241266 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1680 bp · LXL04_037443|LXL04_037443|OH1004|cDNA

ATGAGTGAACACACAAGCCATGAGCAACATGAAGTTGGAGATATAATTGAAAATTTGGTCGATCATATCAGTAATCTACCTGATTCTATTCTTCATTACATTTTGTCGTTTATGCCCACAAAAGAAGCTGTAAAGACGTCCATATTATCTACAAGATGGAAGAACAAAAACCTCTGGGCCTCTACTTCCAAAATTGATTTTAATGACGGTTCGCATCAACCTGACGTCACTTCCTTCGTCAACTTAGTAGAAAGATTCTT...

CDS

Download CDS FASTA

1680 bp · LXL04_037443|LXL04_037443|OH1004|CDS

ATGAGTGAACACACAAGCCATGAGCAACATGAAGTTGGAGATATAATTGAAAATTTGGTCGATCATATCAGTAATCTACCTGATTCTATTCTTCATTACATTTTGTCGTTTATGCCCACAAAAGAAGCTGTAAAGACGTCCATATTATCTACAAGATGGAAGAACAAAAACCTCTGGGCCTCTACTTCCAAAATTGATTTTAATGACGGTTCGCATCAACCTGACGTCACTTCCTTCGTCAACTTAGTAGAAAGATTCTT...

Protein

Download Protein FASTA

559 aa · LXL04_037443|LXL04_037443|OH1004|PROTEIN

MSEHTSHEQHEVGDIIENLVDHISNLPDSILHYILSFMPTKEAVKTSILSTRWKNKNLWASTSKIDFNDGSHQPDVTSFVNLVERFFQLRNALNLEKFHLTCDGYYHESRLYSWISNAIMHNVQELDLALDNVDRSMNPWSILNKTSLVTLKIRMTSFIKLPSRFSFPCLKTFHLASIRFLNCDYSEEPFSGCPVLEELVLLDCKWMKSKYIEISSSTLKSLTLKRDTYISNKILFNNVSSLLKACIHIPSPHTCQNEVA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037443`
TK1151 ID	TkA04G308930
OH-1004 ID	LXL04_037443
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 99.198 / OH-1004 66.369 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_037443

Location Chr09:11235369-11241266 (-)

Description Similar to At3g59200: F-box/LRR-repeat protein At3g59200

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g59200`	F-box/LRR-repeat protein At3g59200.	No verified direct reference in this release
`At3g59240`	Putative F-box/FBD/LRR-repeat protein At3g59240.	No verified direct reference in this release
`At1g16930`	F-box/FBD/LRR-repeat protein At1g16930.	No verified direct reference in this release
`At3g58860`	Putative F-box protein At3g58860.	No verified direct reference in this release
`At3g59230`	Putative F-box/LRR-repeat protein At3g59230.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037443 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G16930

ath:AT3G59200

ath:AT3G59240

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.723

Rank 1 · LXL04_037443 · OH-1004

Cytoplasm0.354

Rank 2 · LXL04_037443 · OH-1004

Cell membrane0.046

Rank 3 · LXL04_037443 · OH-1004

Endoplasmic reticulum0.039

Rank 4 · LXL04_037443 · OH-1004

Mitochondrion0.025

Rank 5 · LXL04_037443 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646.39F-box23-55 aa

PF23622.2LRR_At1g61320_AtMIF193-223 aa

PF08387.16FBD301-342 aa

PF00646.39F-box468-505 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037443	`PF00646.39`	F-box	23	55	1.1e-19	70.2
LXL04_037443	`PF23622.2`	LRR_At1g61320_AtMIF1	93	223	7.5e-06	26.3
LXL04_037443	`PF08387.16`	FBD	301	342	3.5e-06	27.5
LXL04_037443	`PF00646.39`	F-box	468	505	1.1e-19	70.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LX51`	Arabidopsis thaliana	F-box/LRR-repeat protein At3g59200	35.586%	Swiss-Prot	weak database homology
`Q9LX47`	Arabidopsis thaliana	Putative F-box/FBD/LRR-repeat protein At3g59240	30.084%	Swiss-Prot	moderate database homology
`Q9FZ52`	Arabidopsis thaliana	F-box/FBD/LRR-repeat protein At1g16930	35.814%	Swiss-Prot	weak database homology
`Q9LXR6`	Arabidopsis thaliana	Putative F-box protein At3g58860	34.259%	Swiss-Prot	weak database homology
`Q9LX48`	Arabidopsis thaliana	Putative F-box/LRR-repeat protein At3g59230	33.929%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card