TkA04G267310 | RubberDandelionOmics

Gene overview

TkA04G267310

Reference: TK1151 Chr: Chr04 Coordinates: 67555587-67561155 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1932 bp · TkA04G267310|TK1151|cDNA

CAAATACTCCCTTCCAACCCGATCTCAACCCACCATCACCTCCTGCATCTTCTCTCTCTAAACTAACCGGATAAACACCATTCCAATTATTCTTCCACAATGAGGAGCAATCTGAAGTCCAAATTCCTGGAAGTTTACGAGACTCTGAAATCAGAGCTAATTCATGATCCTGCATTTGAGTTCGACGACGATTCTCGTCAGTGGGTTGAACGGATGCTTGACTACAATGTACCTGGAGGAAAGTTAAACAGAGGCCTTTC...

CDS

Download CDS FASTA

1833 bp · TkA04G267310|TK1151|CDS

ATGAGGAGCAATCTGAAGTCCAAATTCCTGGAAGTTTACGAGACTCTGAAATCAGAGCTAATTCATGATCCTGCATTTGAGTTCGACGACGATTCTCGTCAGTGGGTTGAACGGATGCTTGACTACAATGTACCTGGAGGAAAGTTAAACAGAGGCCTTTCTGTTGTGGACAGTTACAAGCTTCTTAAAGGAGAAGAAGAACTAACAGAAGATGAAGTTTTTCTCGCATGTGCTCTTGGTTGGTGCATTGAATGGTACTT...

Protein

Download Protein FASTA

610 aa · TkA04G267310|TK1151|PROTEIN

MRSNLKSKFLEVYETLKSELIHDPAFEFDDDSRQWVERMLDYNVPGGKLNRGLSVVDSYKLLKGEEELTEDEVFLACALGWCIEWYLMTSRMNPIHAEVNHVGSDYAKLVACALLMFGENLDDHVQVKDVLVEMGIYYQVQIRSDIEDFKCSWLVVKALELANEEQKKLLNGVFEDYENKTHEKLVKSIETHPSNAIQAVLTFYEPVDKYIVLSFFLIANVPFIHLMATTAHQYQLTCSCAPKLKENSPKKTKLQAQCRH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G267310`
TK1151 ID	TkA04G267310
OH-1004 ID	LXL04_037275
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	85.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G267310

Location Chr04:67555587-67561155 (-)

Description Similar to FDS-2: Farnesyl diphosphate synthase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g26570`	Acts as a calcium sensor.	A protein kinase, calcineurin B-like protein-interacting protein Kinase9, interacts with calcium sensor calcineurin B-like Protein3 and regulates potassium homeostasis under low-potassium stress in Arabidopsis.2013 · DOI: 10.1104/pp.112.206896
`At5g55990`	Acts as a calcium sensor.	Arabidopsis protein kinase PKS5 inhibits the plasma membrane H+ -ATPase by preventing interaction with 14-3-3 protein.2007 · DOI: 10.1105/tpc.105.035626 S-acylation-dependent association of the calcium sensor CBL2 with the vacuolar membrane is essential for proper abscisic acid responses.2012 · DOI: 10.1038/cr.2012.71

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0626800`	Acts as a calcium sensor.	No verified direct reference in this release
`Os12g0597000`	Acts as a calcium sensor.	A gibberellin-regulated calcineurin B in rice localizes to the tonoplast and is implicated in vacuole function.2005 · DOI: 10.1104/pp.105.062703
`Os12g0162400`	Acts as a calcium sensor.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037275 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006695 cholesterol biosynthetic process Biological Process

GO:0009739 response to gibberellin Biological Process

GO:0033384 geranyl diphosphate biosynthetic process Biological Process

GO:0045337 farnesyl diphosphate biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0004161 dimethylallyltranstransferase activity Molecular Function

GO:0004337 (2E,6E)-farnesyl diphosphate synthase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.893

Rank 1 · TkA04G267310 · TK1151

Cytoplasm0.062

Rank 2 · TkA04G267310 · TK1151

Mitochondrion0.061

Rank 3 · TkA04G267310 · TK1151

Endoplasmic reticulum0.037

Rank 4 · TkA04G267310 · TK1151

Peroxisome0.034

Rank 5 · TkA04G267310 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13499EF-hand_77-34 aa

PF00348polyprenyl_synt34-86 aa

PF00348polyprenyl_synt109-141 aa

PF00348polyprenyl_synt143-184 aa

PF10591SPARC_Ca_bdg153-189 aa

PF21329CYP38_PsbQ-like155-191 aa

PF23564EF-hand_FSTL1160-184 aa

PF05757PsbQ227-410 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G267310	`PF13499`	EF-hand_7	7	34	5.5e-15	56.2
TkA04G267310	`PF00348`	polyprenyl_synt	34	86	6.8e-17	62.2
TkA04G267310	`PF00348`	polyprenyl_synt	109	141	6.8e-17	62.2
TkA04G267310	`PF00348`	polyprenyl_synt	143	184	6.8e-17	62.2
TkA04G267310	`PF10591`	SPARC_Ca_bdg	153	189	0.007	17.4
TkA04G267310	`PF21329`	CYP38_PsbQ-like	155	191	0.0059	17.8
TkA04G267310	`PF23564`	EF-hand_FSTL1	160	184	0.0032	18.6
TkA04G267310	`PF05757`	PsbQ	227	410	2.8e-23	83.8
TkA04G267310	`PF21329`	CYP38_PsbQ-like	322	401	0.0059	17.8
TkA04G267310	`PF12763`	EH	447	513	0.0011	19.6
TkA04G267310	`PF13499`	EF-hand_7	465	513	5.5e-15	56.2
TkA04G267310	`PF13405`	EF-hand_6	465	478	1.5e-13	49.9
TkA04G267310	`PF00036`	EF-hand_1	466	479	3e-17	61.5
TkA04G267310	`PF13202`	EF-hand_5	466	475	2.7e-14	52.6
TkA04G267310	`PF13833`	EF-hand_8	466	512	5.2e-07	30.0
TkA04G267310	`PF30347`	RSA-1_C	475	550	0.0057	17.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LEM7`	Arabidopsis thaliana	sp\|Q8LEM7\|CNBL3_ARATH Calcineurin B-like protein 3	96.400%	Swiss-Prot	Low
`Q8LAS7`	Arabidopsis thaliana	sp\|Q8LAS7\|CNBL2_ARATH Calcineurin B-like protein 2	97.600%	Swiss-Prot	Low
`Q75LU8`	Oryza sativa subsp. japonica	sp\|Q75LU8\|CNBL3_ORYSJ Calcineurin B-like protein 3	96.400%	Swiss-Prot	Low
`Q3HRP5`	Oryza sativa subsp. japonica	sp\|Q3HRP5\|CNBL2_ORYSJ Calcineurin B-like protein 2	92.800%	Swiss-Prot	Low
`Q3HRP1`	Oryza sativa subsp. japonica	sp\|Q3HRP1\|CNBL6_ORYSJ Calcineurin B-like protein 6	78.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card