TkA04G233910 | RubberDandelionOmics

Gene overview

TkA04G233910

Reference: TK1151 Chr: Chr04 Coordinates: 59411281-59426884 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3218 bp · TkA04G233910|TK1151|cDNA

GAAGAAGAGGGCATCACACGATCAATACATCCGATCAATTGTCCGATCAGTTGTCTGTTGTTATAAACCCAAAAATATTTCCACCATTTAGTTCTTCTCTCTCTTTTGTAATCTCTCTCAACGGCCTTACGCTACCACCTTCCTCCACCACCTGCTATCGCCGGCCGCCAACCGCCGCTCGTCACTGTCAACGTTTTCTCTTACGCTACGAGGGTTCAAGGTTGTGCTTTAACATAGTGACAAAAAAGATAAGTTTATGT...

CDS

Download CDS FASTA

1011 bp · TkA04G233910|TK1151|CDS

ATGAGTGTTGAAGTTCAGTGTTCATATACACCGGAAGTTATGAGTAGCTGGAGGAGTCTGATTTTGAGAATCGGCGAGAAGTCGCCGGAATATGGCGGAACAGTCGATCACAAAGACCACATTGACGCATGCTTTGGTGCAGTTCGGCGGGAGCTTGAGCATTCCGAAGACGAAATCTTAACTTTTCTTCTTCAATGTTCTGAGCAATTGCCTCACAAAATCCCTCTGTATGGGACTGTGATTGGGTTATTGAACTTGGA...

Protein

Download Protein FASTA

336 aa · TkA04G233910|TK1151|PROTEIN

MSVEVQCSYTPEVMSSWRSLILRIGEKSPEYGGTVDHKDHIDACFGAVRRELEHSEDEILTFLLQCSEQLPHKIPLYGTVIGLLNLENEDLVKKVLENTHKSLQEALDSGDCNKIRISMRFLTVLMCSKVVQPSSLVVVFETLLSCAATIVDDEKGNPSWQSRADFYITCILSCLPWGGAELVEQIPEEMERVMVGIEAYLSIRRRVSDVGLSVFDDINKDKLHVEQDFVEDLWGRVQDLSKNSWKLESVPRPHLQYEAQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G233910`
TK1151 ID	TkA04G233910
OH-1004 ID	LXL04_039642
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.700
Protein coverage (%)	TK1151 95.833 / OH-1004 37.485 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G233910

Location Chr04:59411281-59426884 (-)

Description Similar to ABH1: Nuclear cap-binding protein subunit 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g13540`	Component of the cap-binding complex (CBC), which binds cotranscriptionally to the 5'-cap of pre-mRNAs and is involved in various processes such as pre-mRNA splicing and RNA-mediated gene silencing (RNAi) by microRNAs (miRNAs).	An mRNA cap binding protein, ABH1, modulates early abscisic acid signal transduction in Arabidopsis.2001 · DOI: 10.1016/s0092-8674(01)00460-3 Localization, ion channel regulation, and genetic interactions during abscisic acid signaling of the nuclear mRNA cap-binding protein, ABH1.2002 · DOI: 10.1104/pp.009480 A link between RNA metabolism and silencing affecting Arabidopsis development.2008 · DOI: 10.1016/j.devcel.2008.04.005 Dual roles of the nuclear cap-binding complex and SERRATE in pre-mRNA splicing and microRNA processing in Arabidopsis thaliana.2008 · DOI: 10.1073/pnas.0802493105 Two cap-binding proteins CBP20 and CBP80 are involved in processing primary MicroRNAs.2008 · DOI: 10.1093/pcp/pcn146

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0347200`	Component of the cap-binding complex (CBC), which binds cotranscriptionally to the 5'-cap of pre-mRNAs and is involved in various processes such as pre-mRNA splicing and RNA-mediated gene silencing (RNAi) by microRNAs (miRNAs).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039642 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000184 nuclear-transcribed mRNA catabolic process, nonsense-mediated decay Biological Process

GO:0000245 spliceosomal complex assembly Biological Process

GO:0000380 alternative mRNA splicing, via spliceosome Biological Process

GO:0000394 RNA splicing, via endonucleolytic cleavage and ligation Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0000956 nuclear-transcribed mRNA catabolic process Biological Process

GO:0002191 cap-dependent translational initiation Biological Process

GO:0006370 7-methylguanosine mRNA capping Biological Process

GO:0006401 RNA catabolic process Biological Process

GO:0006406 mRNA export from nucleus Biological Process

GO:0006408 snRNA export from nucleus Biological Process

GO:0006446 regulation of translational initiation Biological Process

KEGG gene cross-reference

ath:AT2G13540

dgr:6566283

dmo:Dmoj_GI15172

dosa:Os03g0347200

hsa:4686

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.576

Rank 1 · TkA04G233910 · TK1151

Cytoplasm0.430

Rank 2 · TkA04G233910 · TK1151

Golgi apparatus0.067

Rank 3 · TkA04G233910 · TK1151

Cell membrane0.065

Rank 4 · TkA04G233910 · TK1151

Endoplasmic reticulum0.053

Rank 5 · TkA04G233910 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02854MIF4G40-235 aa

PF10274ParcG48-70 aa

PF10274ParcG78-153 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G233910	`PF02854`	MIF4G	40	235	9.2e-27	94.8
TkA04G233910	`PF10274`	ParcG	48	70	0.12	13.2
TkA04G233910	`PF10274`	ParcG	78	153	0.12	13.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SIU2`	Arabidopsis thaliana	sp\|Q9SIU2\|NCBP1_ARATH Nuclear cap-binding protein subunit 1	66.100%	Swiss-Prot	High
`Q10LJ0`	Oryza sativa subsp. japonica	sp\|Q10LJ0\|NCBP1_ORYSJ Nuclear cap-binding protein subunit 1	57.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card