RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_039642
Reference: OH-1004 Chr: JAJTUU010000020.1 Coordinates: 466581-474252 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2605 bp · LXL04_039642|LXL04_039642|OH1004|cDNA

TCAGTGTTCATATACACCGGAAGTTATGAGTAGCTGGAGGAGTCTGATTTTGAGAATCGGCGAGAAGTCGCCGGAATATGGCGGAACAGTCGATCACAAAGACCACATTGACGCATGCTTTGGTGCAGTTCGGCGGGAGCTTGAGCATTCCGAAGACGAAATCTTAACTTTTCTTCTTCAATGTTCTGAGCAATTGCCTCACAAAATCCCTCTGTATGGGACTGTGATTGGGTTATTGAACTTGGAAAACGAGGACCTGG...

CDS

Download CDS FASTA

2580 bp · LXL04_039642|LXL04_039642|OH1004|CDS

ATGAGTAGCTGGAGGAGTCTGATTTTGAGAATCGGCGAGAAGTCGCCGGAATATGGCGGAACAGTCGATCACAAAGACCACATTGACGCATGCTTTGGTGCAGTTCGGCGGGAGCTTGAGCATTCCGAAGACGAAATCTTAACTTTTCTTCTTCAATGTTCTGAGCAATTGCCTCACAAAATCCCTCTGTATGGGACTGTGATTGGGTTATTGAACTTGGAAAACGAGGACCTGGTTAAGAAAGTATTGGAGAACACGCA...

Protein

Download Protein FASTA

859 aa · LXL04_039642|LXL04_039642|OH1004|PROTEIN

MSSWRSLILRIGEKSPEYGGTVDHKDHIDACFGAVRRELEHSEDEILTFLLQCSEQLPHKIPLYGTVIGLLNLENEDLVKKVLENTHKSLQEALDSGDCNKIRISMRFLTVLMCSKVVQPSSLVVVFETLLSCAATIVDDEKGNPSWQSRADFYITCILSCLPWGGAELVEQIPEEMERVMVGIEAYLSIRRRVSDVGLSVFDDINKDKLHVEQDFVEDLWGRVQDLSKNSWKLESVPRPHLQYEAQLVAGKSHDFGSIT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_039642
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_039642
LocationJAJTUU010000020.1:466581-474252 (+)
DescriptionSimilar to ABH1: Nuclear cap-binding protein subunit 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g13540 Component of the cap-binding complex (CBC), which binds cotranscriptionally to the 5'-cap of pre-mRNAs and is involved in various processes such as pre-mRNA splicing and RNA-mediated gene silencing (RNAi) by microRNAs (miRNAs).
An mRNA cap binding protein, ABH1, modulates early abscisic acid signal transduction in Arabidopsis.2001 · DOI: 10.1016/s0092-8674(01)00460-3
Localization, ion channel regulation, and genetic interactions during abscisic acid signaling of the nuclear mRNA cap-binding protein, ABH1.2002 · DOI: 10.1104/pp.009480
A link between RNA metabolism and silencing affecting Arabidopsis development.2008 · DOI: 10.1016/j.devcel.2008.04.005
Dual roles of the nuclear cap-binding complex and SERRATE in pre-mRNA splicing and microRNA processing in Arabidopsis thaliana.2008 · DOI: 10.1073/pnas.0802493105
Two cap-binding proteins CBP20 and CBP80 are involved in processing primary MicroRNAs.2008 · DOI: 10.1093/pcp/pcn146

Rice

Reference gene IDPossible functionPapers / DOI
Os03g0347200 Component of the cap-binding complex (CBC), which binds cotranscriptionally to the 5'-cap of pre-mRNAs and is involved in various processes such as pre-mRNA splicing and RNA-mediated gene silencing (RNAi) by microRNAs (miRNAs). No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_039642 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0000184 nuclear-transcribed mRNA catabolic process, nonsense-mediated decay Biological Process
GO:0000245 spliceosomal complex assembly Biological Process
GO:0000380 alternative mRNA splicing, via spliceosome Biological Process
GO:0000394 RNA splicing, via endonucleolytic cleavage and ligation Biological Process
GO:0000398 mRNA splicing, via spliceosome Biological Process
GO:0000956 nuclear-transcribed mRNA catabolic process Biological Process
GO:0002191 cap-dependent translational initiation Biological Process
GO:0006370 7-methylguanosine mRNA capping Biological Process
GO:0006401 RNA catabolic process Biological Process
GO:0006406 mRNA export from nucleus Biological Process
GO:0006408 snRNA export from nucleus Biological Process
GO:0006446 regulation of translational initiation Biological Process
KEGG gene cross-reference
ath:AT2G13540
dgr:6566283
dmo:Dmoj_GI15172
dosa:Os03g0347200
hsa:4686
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.570
Rank 1 · LXL04_039642 · OH-1004
Nucleus0.390
Rank 2 · LXL04_039642 · OH-1004
Golgi apparatus0.126
Rank 3 · LXL04_039642 · OH-1004
Lysosome / Vacuole0.093
Rank 4 · LXL04_039642 · OH-1004
Cell membrane0.081
Rank 5 · LXL04_039642 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02854.26MIF4G27-222 aa
PF09088.18MIF4G_like343-466 aa
PF09090.18MIF4G_like_2501-820 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_039642PF02854.26MIF4G272222.6e-2693.3
LXL04_039642PF09088.18MIF4G_like3434666.1e-38131.3
LXL04_039642PF09090.18MIF4G_like_25018205.1e-32112.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9SIU2Arabidopsis thalianaNuclear cap-binding protein subunit 163.690%Swiss-Protstrong database homology
Q10LJ0Oryza sativa subsp. japonicaNuclear cap-binding protein subunit 158.891%Swiss-Protstrong database homology

JBrowse

View in Genome Browser