TkA04G232240 | RubberDandelionOmics

Gene overview

TkA04G232240

Reference: TK1151 Chr: Chr04 Coordinates: 58955684-58963983 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2580 bp · TkA04G232240|TK1151|cDNA

ATGAGTAGCTGGAGGAGTCTGATTTTGAGAATCGGCGAGAAGTCGCCGGAATATGGCGGAACAGTCGATCACAAAGACCACATTGACGCATGCTTTGGTGCAGTTCGGCGGGAGCTTGAGCATTCCGAAGACGAAATCTTAACTTTTCTTCTTCAATGTTCTGAGCAATTGCCTCACAAAATCCCTCTGTATGGGACTGTGATTGGGTTATTGAACTTGGAAAACGAGGACCTGGTTAAGAAAGTATTGGAGAACACGCA...

CDS

Download CDS FASTA

2580 bp · TkA04G232240|TK1151|CDS

ATGAGTAGCTGGAGGAGTCTGATTTTGAGAATCGGCGAGAAGTCGCCGGAATATGGCGGAACAGTCGATCACAAAGACCACATTGACGCATGCTTTGGTGCAGTTCGGCGGGAGCTTGAGCATTCCGAAGACGAAATCTTAACTTTTCTTCTTCAATGTTCTGAGCAATTGCCTCACAAAATCCCTCTGTATGGGACTGTGATTGGGTTATTGAACTTGGAAAACGAGGACCTGGTTAAGAAAGTATTGGAGAACACGCA...

Protein

Download Protein FASTA

859 aa · TkA04G232240|TK1151|PROTEIN

MSSWRSLILRIGEKSPEYGGTVDHKDHIDACFGAVRRELEHSEDEILTFLLQCSEQLPHKIPLYGTVIGLLNLENEDLVKKVLENTHKSLQEALDSGDCNKIRISMRFLTVLMCSKVVQPSSLVVVFETLLSCAATIVDDEKGNPSWQSRADFYITCILSCLPWGGAELVEQIPEEMERVMVGIEAYLSIRRRVSDVGLSVFDDINKDKLHVEQDFVEDLWGRVQDLSKNSWKLESVPRPHLQYEAQLVAGKSHDFGSIT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G232240`
TK1151 ID	TkA04G232240
OH-1004 ID	LXL04_039642
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G232240

Location Chr04:58955684-58963983 (-)

Description Similar to ABH1: Nuclear cap-binding protein subunit 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g13540`	Component of the cap-binding complex (CBC), which binds cotranscriptionally to the 5'-cap of pre-mRNAs and is involved in various processes such as pre-mRNA splicing and RNA-mediated gene silencing (RNAi) by microRNAs (miRNAs).	An mRNA cap binding protein, ABH1, modulates early abscisic acid signal transduction in Arabidopsis.2001 · DOI: 10.1016/s0092-8674(01)00460-3 Localization, ion channel regulation, and genetic interactions during abscisic acid signaling of the nuclear mRNA cap-binding protein, ABH1.2002 · DOI: 10.1104/pp.009480 A link between RNA metabolism and silencing affecting Arabidopsis development.2008 · DOI: 10.1016/j.devcel.2008.04.005 Dual roles of the nuclear cap-binding complex and SERRATE in pre-mRNA splicing and microRNA processing in Arabidopsis thaliana.2008 · DOI: 10.1073/pnas.0802493105 Two cap-binding proteins CBP20 and CBP80 are involved in processing primary MicroRNAs.2008 · DOI: 10.1093/pcp/pcn146

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0347200`	Component of the cap-binding complex (CBC), which binds cotranscriptionally to the 5'-cap of pre-mRNAs and is involved in various processes such as pre-mRNA splicing and RNA-mediated gene silencing (RNAi) by microRNAs (miRNAs).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_039642 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000184 nuclear-transcribed mRNA catabolic process, nonsense-mediated decay Biological Process

GO:0000245 spliceosomal complex assembly Biological Process

GO:0000380 alternative mRNA splicing, via spliceosome Biological Process

GO:0000394 RNA splicing, via endonucleolytic cleavage and ligation Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0000956 nuclear-transcribed mRNA catabolic process Biological Process

GO:0002191 cap-dependent translational initiation Biological Process

GO:0006370 7-methylguanosine mRNA capping Biological Process

GO:0006401 RNA catabolic process Biological Process

GO:0006406 mRNA export from nucleus Biological Process

GO:0006408 snRNA export from nucleus Biological Process

GO:0006446 regulation of translational initiation Biological Process

KEGG gene cross-reference

ath:AT2G13540

dgr:6566283

dmo:Dmoj_GI15172

dosa:Os03g0347200

hsa:4686

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.581

Rank 1 · TkA04G232240 · TK1151

Nucleus0.375

Rank 2 · TkA04G232240 · TK1151

Golgi apparatus0.132

Rank 3 · TkA04G232240 · TK1151

Lysosome / Vacuole0.096

Rank 4 · TkA04G232240 · TK1151

Cell membrane0.084

Rank 5 · TkA04G232240 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02854MIF4G27-222 aa

PF19111DUF5798214-229 aa

PF09088MIF4G_like306-343 aa

PF09088MIF4G_like343-466 aa

PF02854MIF4G350-409 aa

PF09090MIF4G_like_2501-820 aa

PF19111DUF5798641-678 aa

PF26666DUF8221641-681 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G232240	`PF02854`	MIF4G	27	222	2.6e-26	93.3
TkA04G232240	`PF19111`	DUF5798	214	229	0.058	14.3
TkA04G232240	`PF09088`	MIF4G_like	306	343	6.1e-38	131.2
TkA04G232240	`PF09088`	MIF4G_like	343	466	6.1e-38	131.2
TkA04G232240	`PF02854`	MIF4G	350	409	2.6e-26	93.3
TkA04G232240	`PF09090`	MIF4G_like_2	501	820	4.5e-32	112.3
TkA04G232240	`PF19111`	DUF5798	641	678	0.058	14.3
TkA04G232240	`PF26666`	DUF8221	641	681	0.69	10.8
TkA04G232240	`PF26666`	DUF8221	694	734	0.69	10.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SIU2`	Arabidopsis thaliana	sp\|Q9SIU2\|NCBP1_ARATH Nuclear cap-binding protein subunit 1	64.000%	Swiss-Prot	High
`Q10LJ0`	Oryza sativa subsp. japonica	sp\|Q10LJ0\|NCBP1_ORYSJ Nuclear cap-binding protein subunit 1	59.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card