TkA04G129870 | RubberDandelionOmics

Gene overview

TkA04G129870

Reference: TK1151 Chr: Chr04 Coordinates: 33813387-33817748 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3399 bp · TkA04G129870|TK1151|cDNA

AACCTCTAATGCACAATGTACAACCCCATGACAAAAAGAGCTGTGCACCGACCCTAATGAATGATTAAGTTTCCTTCCTTCGTCTCTTGAAAATAATGCTCTGCTCAAATTACTACCAGTAACAGTGTAACACCAATCTCTCTCTTTGTCTTTCCCTTTCTCTCTCTCTGCTGTTAATTACAAGATTTGCTCAGCCATATCTGGAGCAAAGCAATATACAAGTGTAGCCATTCTACCAATTCCAGTTCCGGCTGCATCAT...

CDS

Download CDS FASTA

2661 bp · TkA04G129870|TK1151|CDS

ATGTCTGCTAAATCCAAATCTTCTTCTTCTGAAACTCCTCCCGCCACCAAAATCCCGATCAGTAAAACATCACCGGCAACACCCAGAGTGAGTAAACTTAACAGGGGAGTTGCTAAATCCGAGATTGATTCACCATCTCCCCTCCAAACCACGAGAGCCTCTGTGGAACGTTCACCCCGATCTGTTCCTTCAAAGCCTGCACTAGATCGTCGCTCCCCAAAGACCAGCAACCTTGCAGAAAAACCAGCTCCAAGGGTAGT...

Protein

Download Protein FASTA

886 aa · TkA04G129870|TK1151|PROTEIN

MSAKSKSSSSETPPATKIPISKTSPATPRVSKLNRGVAKSEIDSPSPLQTTRASVERSPRSVPSKPALDRRSPKTSNLAEKPAPRVVVPKGSELQAQLNALQDDLKKAEEKLLLVEKEKEKAINELKEAQKQSEDTNEKLREALVAQKNAEESIEIEKFRSVEMEQAGIDAAHKKEEQWEKELESVKNQHAADLAALLSATQELEKVKQELAMTCDAKDQALTHADDATKIAENQVEKVETLSAEVTRLKALLNSKFESE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G129870`
TK1151 ID	TkA04G129870
OH-1004 ID	LXL04_035450
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G129870

Location Chr04:33813387-33817748 (+)

Description Similar to At5g16730: WEB family protein At5g16730, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g27595`	WEB family protein At4g27595, chloroplastic.	No verified direct reference in this release
`At3g02930`	WEB family protein At3g02930, chloroplastic.	No verified direct reference in this release
`At5g16730`	WEB family protein At5g16730, chloroplastic.	No verified direct reference in this release
`At1g65010`	Putative WEB family protein At1g65010, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035450 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007131 reciprocal meiotic recombination Biological Process

GO:0080175 phragmoplast microtubule organization Biological Process

GO:0005634 nucleus Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005875 microtubule associated complex Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009524 phragmoplast Cellular Component

GO:0009536 plastid Cellular Component

KEGG gene cross-reference

ath:AT1G65010

ath:AT3G02930

ath:AT5G16730

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.508

Rank 1 · TkA04G129870 · TK1151

Cell membrane0.296

Rank 2 · TkA04G129870 · TK1151

Nucleus0.206

Rank 3 · TkA04G129870 · TK1151

Golgi apparatus0.080

Rank 4 · TkA04G129870 · TK1151

Endoplasmic reticulum0.061

Rank 5 · TkA04G129870 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05701WEMBL90-416 aa

PF19220Rod_CreS92-351 aa

PF13863DUF420093-146 aa

PF13863DUF4200156-251 aa

PF13863DUF4200256-348 aa

PF20878REST_helical259-297 aa

PF20878REST_helical275-317 aa

PF19220Rod_CreS311-477 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G129870	`PF05701`	WEMBL	90	416	5.7e-08	32.7
TkA04G129870	`PF19220`	Rod_CreS	92	351	0.0046	16.9
TkA04G129870	`PF13863`	DUF4200	93	146	0.018	16.1
TkA04G129870	`PF13863`	DUF4200	156	251	0.018	16.1
TkA04G129870	`PF13863`	DUF4200	256	348	0.018	16.1
TkA04G129870	`PF20878`	REST_helical	259	297	0.87	10.5
TkA04G129870	`PF20878`	REST_helical	275	317	0.87	10.5
TkA04G129870	`PF19220`	Rod_CreS	311	477	0.0046	16.9
TkA04G129870	`PF13863`	DUF4200	364	432	0.018	16.1
TkA04G129870	`PF05701`	WEMBL	390	545	5.7e-08	32.7
TkA04G129870	`PF20878`	REST_helical	404	432	0.87	10.5
TkA04G129870	`PF13863`	DUF4200	445	527	0.018	16.1
TkA04G129870	`PF19220`	Rod_CreS	494	606	0.0046	16.9
TkA04G129870	`PF13863`	DUF4200	530	626	0.018	16.1
TkA04G129870	`PF20878`	REST_helical	530	580	0.87	10.5
TkA04G129870	`PF05701`	WEMBL	557	748	5.7e-08	32.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JJP1`	Arabidopsis thaliana	sp\|F4JJP1\|Y4759_ARATH WEB family protein At4g27595, chloroplastic	40.300%	Swiss-Prot	Medium
`Q9M8T5`	Arabidopsis thaliana	sp\|Q9M8T5\|Y3293_ARATH WEB family protein At3g02930, chloroplastic	33.000%	Swiss-Prot	Medium
`Q9LFE4`	Arabidopsis thaliana	sp\|Q9LFE4\|Y5673_ARATH WEB family protein At5g16730, chloroplastic	30.100%	Swiss-Prot	Medium
`F4I8B9`	Arabidopsis thaliana	sp\|F4I8B9\|Y1501_ARATH Putative WEB family protein At1g65010, chloroplastic	55.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card