TkA04G129650 | RubberDandelionOmics

Gene overview

TkA04G129650

Reference: TK1151 Chr: Chr04 Coordinates: 33733657-33738558 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4514 bp · TkA04G129650|TK1151|cDNA

AATCCGGAACGGATAAATACAAAAGATACAAGCGATGTCGCTTAGCCAGTCGTTGTCGCTGAGCTAAGGACAGACACTTAAGCTAATCTATACAAAAGAACTAATATACATACTTAACGTATAAGCGGATAAACCATAAGCGGATACTTTTGAACTTTAGCAGATTATAAGGTTCGACCTTACAGTTTCATCTTATTTTGTACACATAATGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA...

CDS

Download CDS FASTA

2991 bp · TkA04G129650|TK1151|CDS

ATGTTGATGCAGGTAACCGGTTCCGGAGTGGGAGGTGTGAGTGTAACAGCAAATAGAGTGGTGGGTGTCGAAAGATGGCGGATGGAAGGATCGCCGTCGCCAACCCTCCTCCGATTCCGTCACTTTGAGTTGAATATTTCCCCATTATCTTATTCTGCGTTTGCTGGATGCTCGCCGTCACACTTGTCTTGGACCTTGCCGTTACGATTCAACATCCGGAACTGTTCCGATAAGAAAACCACCATCAGTATCAGCCCCAC...

Protein

Download Protein FASTA

996 aa · TkA04G129650|TK1151|PROTEIN

MLMQVTGSGVGGVSVTANRVVGVERWRMEGSPSPTLLRFRHFELNISPLSYSAFAGCSPSHLSWTLPLRFNIRNCSDKKTTISISPTKRGRRTSKNKKTTPGGTRVARTEITSEPVADDNSSEIRGKQEDRNKDGAVNLRSLSQNGDPLGRRDLGKSVVKWLSQGMKAMATDFGAAELQGEFAEVRQRMGPGLTFVIQAQPYLGAIPMPSGLESVCLKACTHYPTVFDHFQRELRDALQQLQRKSLVEDWQKTESWKLLK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G129650`
TK1151 ID	TkA04G129650
OH-1004 ID	LXL04_035456
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 99.699 / OH-1004 88.032 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA04G129650`
Location	Chr04:33733657-33738558 (+)
Description	Similar to IGHMBP2: DNA-binding protein SMUBP-2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_035456` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006412 translation Biological Process GO:0006974 DNA damage response Biological Process GO:1903459 mitotic DNA replication lagging strand elongation Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0016020 membrane Cellular Component GO:0016604 nuclear body Cellular Component GO:0033203 DNA helicase A complex Cellular Component
KEGG gene cross-reference	hsa:3508 maua:101836074 rno:29532 spo:2539412 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.850

Rank 1 · TkA04G129650 · TK1151

Mitochondrion0.155

Rank 2 · TkA04G129650 · TK1151

Cytoplasm0.065

Rank 3 · TkA04G129650 · TK1151

Nucleus0.057

Rank 4 · TkA04G129650 · TK1151

Peroxisome0.027

Rank 5 · TkA04G129650 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13479AAA_24154-189 aa

PF13361UvrD_C218-276 aa

PF13191AAA_16227-267 aa

PF00580UvrD-helicase232-308 aa

PF24883NPHP3_N233-263 aa

PF05373Pro_3_hydrox_C233-276 aa

PF13086AAA_11236-275 aa

PF01637ATPase_2243-267 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G129650	`PF13479`	AAA_24	154	189	0.29	11.5
TkA04G129650	`PF13361`	UvrD_C	218	276	0.11	12.7
TkA04G129650	`PF13191`	AAA_16	227	267	0.004	18.4
TkA04G129650	`PF00580`	UvrD-helicase	232	308	1.5e-05	25.5
TkA04G129650	`PF24883`	NPHP3_N	233	263	0.019	15.9
TkA04G129650	`PF05373`	Pro_3_hydrox_C	233	276	0.13	13.1
TkA04G129650	`PF13086`	AAA_11	236	275	2.4e-57	195.4
TkA04G129650	`PF01637`	ATPase_2	243	267	0.0062	17.1
TkA04G129650	`PF10412`	TrwB_AAD_bind	252	274	0.025	14.2
TkA04G129650	`PF01443`	Viral_helicase1	267	293	1.1e-06	29.3
TkA04G129650	`PF01695`	IstB_IS21	269	326	0.058	13.6
TkA04G129650	`PF19995`	iSTAND	318	351	0.077	14.1
TkA04G129650	`PF21138`	SMUBP-2_HCS1_1B	357	435	2.9e-05	24.6
TkA04G129650	`PF05373`	Pro_3_hydrox_C	449	480	0.13	13.1
TkA04G129650	`PF13086`	AAA_11	522	739	2.4e-57	195.4
TkA04G129650	`PF13604`	AAA_30	522	593	3.4e-13	50.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card