TkA04G124520 | RubberDandelionOmics

Gene overview

TkA04G124520

Reference: TK1151 Chr: Chr04 Coordinates: 32358358-32365946 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1704 bp · TkA04G124520|TK1151|cDNA

GTTTTTCAAACGATTACGCAACACATTTTGGCCAGCGCATAAACCAACGCAAATCCAATCACAAGATGCCTCATTTTCTCCAATCTCTTCCTTATTATTATACCATATTTACTGAGATTCCCAGATATTCAATTTCATCATCTTCTGATCTTCAATTCCTCAGATTTCACTCACCACCATCTGCAATTTCCGCTCTCCATCGTCTTTCATTCCATCTTTCATCCTCAGTATGGCGTCTTCCCTGGGTTTCACCCATCTCA...

CDS

Download CDS FASTA

1983 bp · TkA04G124520|TK1151|CDS

ATGGCGTCTTCCCTGGGTTTCACCCATCTCAATGGCCTCACATCCTCCCGCGTCGCTTATCCAGCGTCCCGCCGCCGTGCAAGTGGCGGAGCTAGAGTCGGTAGTTTGAAGATCTTTGCTTCAGAGTCGAAGCAACAAGAACCTGATCTGAGCGTCAACGTTAATGGTTTGCATATGCCCAATCCATTCGTCATCGGGTCGGGACCTCCAGGGACCAACTATAAAGTCATGAAGAAAGCTTTCGATGAAGGCTGGGGTGC...

Protein

Download Protein FASTA

660 aa · TkA04G124520|TK1151|PROTEIN

MASSLGFTHLNGLTSSRVAYPASRRRASGGARVGSLKIFASESKQQEPDLSVNVNGLHMPNPFVIGSGPPGTNYKVMKKAFDEGWGAVIAKTVSLDAAKVINVTPRYARLRAGANGSAKGQIIGWQNIELISDRPLETMLKEFKQLKEEYPDRILIASIMEEYNKGAWEELVDRVEQTGIDAIEVNFSCPHGMPERKMGAAVGQDCDLLEEVCGWINAKATVPVWAKMTPNITDITQPARVSLRSGCEGVAAINTIMSIF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G124520`
TK1151 ID	TkA04G124520
OH-1004 ID	LXL04_035538
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.500
Protein coverage (%)	TK1151 100.000 / OH-1004 85.751 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G124520

Location Chr04:32358358-32365946 (+)

Description Similar to PYD1: Dihydropyrimidine dehydrogenase (NADP(+)), chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g17810`	Involved in pyrimidine base degradation.	A functional analysis of the pyrimidine catabolic pathway in Arabidopsis.2009 · DOI: 10.1111/j.1469-8137.2009.02843.x Pyrimidine degradation influences germination seedling growth and production of Arabidopsis seeds.2011 · DOI: 10.1093/jxb/err251

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035538 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006145 purine nucleobase catabolic process Biological Process

GO:0006208 pyrimidine nucleobase catabolic process Biological Process

GO:0006210 thymine catabolic process Biological Process

GO:0006212 uracil catabolic process Biological Process

GO:0006214 thymidine catabolic process Biological Process

GO:0006248 CMP catabolic process Biological Process

GO:0006249 dCMP catabolic process Biological Process

GO:0007584 response to nutrient Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009410 response to xenobiotic stimulus Biological Process

GO:0019483 beta-alanine biosynthetic process Biological Process

GO:0019860 uracil metabolic process Biological Process

KEGG gene cross-reference

ath:AT3G17810

ece:Z3402

ecj:JW2134

eco:b2147

ecoc:C3026_12030

ecs:ECs_3039

mmu:99586

stm:STM2187

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.885

Rank 1 · TkA04G124520 · TK1151

Cytoplasm0.077

Rank 2 · TkA04G124520 · TK1151

Mitochondrion0.070

Rank 3 · TkA04G124520 · TK1151

Nucleus0.039

Rank 4 · TkA04G124520 · TK1151

Peroxisome0.033

Rank 5 · TkA04G124520 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01180DHO_dh50-350 aa

PF01207Dus170-235 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G124520	`PF01180`	DHO_dh	50	350	1.5e-33	117.0
TkA04G124520	`PF01207`	Dus	170	235	0.0022	17.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LVI9`	Arabidopsis thaliana	sp\|Q9LVI9\|DPYD_ARATH Dihydropyrimidine dehydrogenase (NADP(+)), chloroplastic	81.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card