TkA04G118510 | RubberDandelionOmics

Gene overview

TkA04G118510

Reference: TK1151 Chr: Chr04 Coordinates: 30832808-30834189 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

934 bp · TkA04G118510|TK1151|cDNA

CTTACAGATACGTTTCAGTTGACGATTTCGTTCACTTTTTCCGAAACTTTCACACCGGTTTAAAGATCTCCGCCGTTCTTCATGTTCCGTACGACAAATCTAAAGCTCATCCGGCGGCTCTTGTCACAAACAAATACGGATATCGAACAATGAACTCTTCAAGGCGTGTTTATCGAGAGAATGGCTTCTAATGAAGAGAAATGCTTTTGTGTACATTTTCAAGACTACACAAATCACAATCATGGCTTTGTTCACCTTCA...

CDS

Download CDS FASTA

744 bp · TkA04G118510|TK1151|CDS

ATGAAGAGAAATGCTTTTGTGTACATTTTCAAGACTACACAAATCACAATCATGGCTTTGTTCACCTTCACCATGTTTTTCCGTACAACAATGAAGCATGGCGATATCGATGATGGCGGGAAGTACTATGGGGCGTTGTTTTTTAGTTTGATTAACGTCATGTTTAACGGTATGGCTGAGCTTGCTTTGACGATTTTCCGGCTACCGGTGTTCTATAAACAAAGGGATTCACTTTTTTATCCGGCGTGGGCTTTTGCTCT...

Protein

Download Protein FASTA

248 aa · TkA04G118510|TK1151|PROTEIN

MKRNAFVYIFKTTQITIMALFTFTMFFRTTMKHGDIDDGGKYYGALFFSLINVMFNGMAELALTIFRLPVFYKQRDSLFYPAWAFALPIWLLRLPLSLLESGIWILLTYYTIGFAPSASSFFRQLLAYLGIHQMALGLFRFIAALGRTQVVANTLGTFTLLLVFVLGGFIIAKDDLQPWMKWAYYLSPMSYGQNAIVLVEFLDKRWSTPYLNSSSGESTVGKELLRDRGMFTEGHWYWICVLALFGFS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G118510`
TK1151 ID	TkA04G118510
OH-1004 ID	LXL04_035590
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 16.859 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G118510

Location Chr04:30832808-30834189 (+)

Description Similar to PDR2: Pleiotropic drug resistance protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g66950`	May be a general defense protein.	No verified direct reference in this release
`At2g36380`	May be a general defense protein.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0544400`	May be a general defense protein.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035590 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000302 response to reactive oxygen species Biological Process

GO:0009914 hormone transport Biological Process

GO:0042908 xenobiotic transport Biological Process

GO:2000032 regulation of secondary shoot formation Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

GO:0140359 ABC-type transporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G66950

ath:AT2G36380

dosa:Os11g0587600

nta:107799533

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.608

Rank 1 · TkA04G118510 · TK1151

Endoplasmic reticulum0.143

Rank 2 · TkA04G118510 · TK1151

Lysosome / Vacuole0.107

Rank 3 · TkA04G118510 · TK1151

Cytoplasm0.101

Rank 4 · TkA04G118510 · TK1151

Golgi apparatus0.069

Rank 5 · TkA04G118510 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01061ABC2_membrane1-201 aa

PF08370PDR_assoc15-29 aa

PF08370PDR_assoc52-66 aa

PF08370PDR_assoc211-248 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G118510	`PF01061`	ABC2_membrane	1	201	1.4e-44	152.9
TkA04G118510	`PF08370`	PDR_assoc	15	29	1.9e-12	47.4
TkA04G118510	`PF08370`	PDR_assoc	52	66	1.9e-12	47.4
TkA04G118510	`PF08370`	PDR_assoc	211	248	1.9e-12	47.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7PC84`	Arabidopsis thaliana	sp\|Q7PC84\|AB39G_ARATH ABC transporter G family member 39	69.400%	Swiss-Prot	High
`Q7PC87`	Arabidopsis thaliana	sp\|Q7PC87\|AB34G_ARATH ABC transporter G family member 34	66.100%	Swiss-Prot	High
`Q8GU82`	Oryza sativa subsp. japonica	sp\|Q8GU82\|AB45G_ORYSJ ABC transporter G family member 45	52.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card