LXL04_035590 | RubberDandelionOmics

Gene overview

LXL04_035590

Reference: OH-1004 Chr: Chr08 Coordinates: 25122774-25129994 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4416 bp · LXL04_035590|LXL04_035590|OH1004|cDNA

ATGGCTTCTGCATTAGCCGGTGATGACCTCATGAGGTCCATGAGCCGGAATATGAGCCGGAACATGAGCCGCAACTTGAGCCGAAGAGGTAGTCTAGCCTCAAGAAGCACCAGGGGTTGGGGTACAGCCAGTATCAGGGAAGCATTCACTACACCAGGTCCCGATATCTTCCAGAAAAGTGGgagagaagatgatgaagatgaactCATGTGGGCTGCCATTGAAAGGCTCCCCACTTATGATCGATTAAGAAAAGGATT...

CDS

Download CDS FASTA

4416 bp · LXL04_035590|LXL04_035590|OH1004|CDS

ATGGCTTCTGCATTAGCCGGTGATGACCTCATGAGGTCCATGAGCCGGAATATGAGCCGGAACATGAGCCGCAACTTGAGCCGAAGAGGTAGTCTAGCCTCAAGAAGCACCAGGGGTTGGGGTACAGCCAGTATCAGGGAAGCATTCACTACACCAGGTCCCGATATCTTCCAGAAAAGTGGGAGAGAAGATGATGAAGATGAACTCATGTGGGCTGCCATTGAAAGGCTCCCCACTTATGATCGATTAAGAAAAGGATT...

Protein

Download Protein FASTA

1471 aa · LXL04_035590|LXL04_035590|OH1004|PROTEIN

MASALAGDDLMRSMSRNMSRNMSRNLSRRGSLASRSTRGWGTASIREAFTTPGPDIFQKSGREDDEDELMWAAIERLPTYDRLRKGFLTQVLDDGKVVREEIDVANLGPEERQNLMKNIQEGIDNDNERLLERLRDRIDRVGIEVPRIEIRYQDLSIEGDAFVGSRALPTLLNSTINSIEASFSSFNMITCFLIVYLQKMNVLGFMRLFPTKKRVVKILHEVSGIVTPSRMTLLLGPPGSGKTTLLKALAGKLERDLRVT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035590`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035590

Location Chr08:25122774-25129994 (-)

Description Similar to PDR2: Pleiotropic drug resistance protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g36380`	May be a general defense protein.	No verified direct reference in this release
`At1g66950`	May be a general defense protein.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0587600`	May be a general defense protein.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035590 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000302 response to reactive oxygen species Biological Process

GO:0009914 hormone transport Biological Process

GO:0042908 xenobiotic transport Biological Process

GO:2000032 regulation of secondary shoot formation Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

GO:0140359 ABC-type transporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G66950

ath:AT2G36380

dosa:Os11g0587600

nta:107799533

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.604

Rank 1 · LXL04_035590 · OH-1004

Endoplasmic reticulum0.182

Rank 2 · LXL04_035590 · OH-1004

Cytoplasm0.119

Rank 3 · LXL04_035590 · OH-1004

Lysosome / Vacuole0.106

Rank 4 · LXL04_035590 · OH-1004

Golgi apparatus0.090

Rank 5 · LXL04_035590 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14510.12ABC_trans_N125-173 aa

PF00005.34ABC_tran219-400 aa

PF13191.13AAA_16225-266 aa

PF19055.7ABC2_membrane_7434-484 aa

PF01061.30ABC2_membrane555-767 aa

PF08370.17PDR_assoc777-835 aa

PF00005.34ABC_tran898-1050 aa

PF19055.7ABC2_membrane_71079-1146 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035590	`PF14510.12`	ABC_trans_N	125	173	4.2e-07	31.0
LXL04_035590	`PF00005.34`	ABC_tran	219	400	5.3e-40	137.9
LXL04_035590	`PF13191.13`	AAA_16	225	266	3.5e-08	34.9
LXL04_035590	`PF19055.7`	ABC2_membrane_7	434	484	3.1e-15	56.7
LXL04_035590	`PF01061.30`	ABC2_membrane	555	767	1.8e-104	348.6
LXL04_035590	`PF08370.17`	PDR_assoc	777	835	1.4e-22	79.9
LXL04_035590	`PF00005.34`	ABC_tran	898	1050	5.3e-40	137.9
LXL04_035590	`PF19055.7`	ABC2_membrane_7	1079	1146	3.1e-15	56.7
LXL04_035590	`PF01061.30`	ABC2_membrane	1195	1408	1.8e-104	348.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7PC87`	Arabidopsis thaliana	ABC transporter G family member 34	68.234%	Swiss-Prot	strong database homology
`Q7PC84`	Arabidopsis thaliana	ABC transporter G family member 39	68.219%	Swiss-Prot	strong database homology
`Q8GU84`	Oryza sativa subsp. japonica	ABC transporter G family member 48	57.478%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card