TkA04G107870 | RubberDandelionOmics

Gene overview

TkA04G107870

Reference: TK1151 Chr: Chr04 Coordinates: 28042063-28048691 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1600 bp · TkA04G107870|TK1151|cDNA

TTTTGCGACTCCACTGCGCGCTAGACCACTCAGTCGAGGCCACCAGAATAGAATGGCGACGATGGCAGCAAGAAACCTTTCGCTAGCTCCGGTAGCGACTCGGTTTGGTAGTTGTATGTCAACTCGTTTTCTCGTTAAACCTCTATCGGTCATGGTGAATTCACCTCTTTATAGGAACTTCGCTGCAAAAATCCGCGCGTCATCTGCAATCGCCACGGTCGAAACCATACAGGGAACTTGTTTAAATGAAAACGAGGCAA...

CDS

Download CDS FASTA

1167 bp · TkA04G107870|TK1151|CDS

ATGCTACTATATTTTTTGTATTTATATAATTCTTGGTTATTTTTTCTTCTTCTTTTAATTCTTGCAAATACTTTACGACATGCCACTCAGTCGAGGGCCACCGAAACAGCGACCATGGCAGCAGACAACCTTTCCCCACCTCCGGTAGCGACGGGGTTTGGTACTTCTTTGTCAACTCGTTTTTTCAAGAAACCTCTATCGTTCATTGTGAATTCATCCCTTTATCGGAACTTCGCTGCAAAATTCCTAACGTCATCTTC...

Protein

Download Protein FASTA

388 aa · TkA04G107870|TK1151|PROTEIN

MLLYFLYLYNSWLFFLLLLILANTLRHATQSRATETATMAADNLSPPPVATGFGTSLSTRFFKKPLSFIVNSSLYRNFAAKFLTSSSIANLENMLATDLIENETNAKKVLACPICYEILIWNGDPVFSVDSTPRSILKCGTCKKSYSGKETYLDLTVASGAKKYGEYVPASSELFRLPLVSFLYERGWRQAFSISGGFPGPQKEFEMMKDYLNPIIGGNIIDASCGSGMFSRLFQKSGLFSLVVALDYSESMLKQSYDFI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G107870`
TK1151 ID	TkA04G107870
OH-1004 ID	LXL04_035799
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	89.200
Protein coverage (%)	TK1151 95.103 / OH-1004 49.134 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G107870

Location Chr04:28042063-28048691 (-)

Description Similar to At1g78140: Uncharacterized methyltransferase At1g78140, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g78140`	Uncharacterized methyltransferase At1g78140, chloroplastic.	No verified direct reference in this release
`At2g41040`	Uncharacterized methyltransferase At2g41040, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035799 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009234 menaquinone biosynthetic process Biological Process

GO:0032259 methylation Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0010287 plastoglobule Cellular Component

GO:0008168 methyltransferase activity Molecular Function

GO:0008757 S-adenosylmethionine-dependent methyltransferase activity Molecular Function

GO:0043770 demethylmenaquinone methyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G78140

ath:AT2G41040

sab:SAB1333c

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.969

Rank 1 · TkA04G107870 · TK1151

Mitochondrion0.034

Rank 2 · TkA04G107870 · TK1151

Nucleus0.026

Rank 3 · TkA04G107870 · TK1151

Cytoplasm0.024

Rank 4 · TkA04G107870 · TK1151

Peroxisome0.016

Rank 5 · TkA04G107870 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08003Methyltransf_9206-376 aa

PF01209Ubie_methyltran209-322 aa

PF13489Methyltransf_23217-326 aa

PF13847Methyltransf_31218-326 aa

PF13649Methyltransf_25220-318 aa

PF08241Methyltransf_11222-321 aa

PF08242Methyltransf_12222-320 aa

PF03141Methyltransf_29277-324 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G107870	`PF08003`	Methyltransf_9	206	376	0.00016	21.5
TkA04G107870	`PF01209`	Ubie_methyltran	209	322	1.3e-09	38.5
TkA04G107870	`PF13489`	Methyltransf_23	217	326	2.5e-07	31.3
TkA04G107870	`PF13847`	Methyltransf_31	218	326	2.5e-12	47.5
TkA04G107870	`PF13649`	Methyltransf_25	220	318	5.7e-15	56.5
TkA04G107870	`PF08241`	Methyltransf_11	222	321	6.1e-19	69.2
TkA04G107870	`PF08242`	Methyltransf_12	222	320	2.1e-10	41.9
TkA04G107870	`PF03141`	Methyltransf_29	277	324	0.002	17.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LBV4`	Arabidopsis thaliana	sp\|Q8LBV4\|Y1814_ARATH Uncharacterized methyltransferase At1g78140, chloroplastic	66.000%	Swiss-Prot	High
`Q0WPT7`	Arabidopsis thaliana	sp\|Q0WPT7\|Y2104_ARATH Uncharacterized methyltransferase At2g41040, chloroplastic	48.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card