TkA04G102630 | RubberDandelionOmics

Gene overview

TkA04G102630

Reference: TK1151 Chr: Chr04 Coordinates: 26682098-26685126 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2016 bp · TkA04G102630|TK1151|cDNA

CTCTCCAAAAGAGCCCTTGTGGAGAGAGGGGATACTCCAACATATATAGACACTTATAGATCGTGTTCGCACCGATGTGGGATACACTAACACCCCCATGTCATTCAAAAGCCATATCCTTTAATAAGATGATCTCTTTTTCGAGATTAATAATCCACAGATTAATTAAATGATATATACATAACGCATAGAGTGCTGTACTTTATTCTGAATATGTTAATCGTGAAACTGGCATAGCAGCTGGCCTTTTTTAATTGCAA...

CDS

Download CDS FASTA

1080 bp · TkA04G102630|TK1151|CDS

ATGGCAACAACTTCCACTCAATTTGCAACGTCAAGAAGAATGGGAATATACGATCCACTTCAACAAATTAGCATGTGGGATGATGCTTTTGGAGCTAATTTGAACTCCGGTATCATGTTACCTCCTCCTCAGGTCACCAACAAGACGGAATACAATTCTCAGGAATCATTAGAACCATCACCGGATCCCCGAGCAACAAGAAACATTTCAGATAAGTTGCAGAGACGACTTGCACAGAATCGTGAAGCTGCACGTAAAAG...

Protein

Download Protein FASTA

359 aa · TkA04G102630|TK1151|PROTEIN

MATTSTQFATSRRMGIYDPLQQISMWDDAFGANLNSGIMLPPPQVTNKTEYNSQESLEPSPDPRATRNISDKLQRRLAQNREAARKSRLRKKAYVQQLESGRLKLVQLEQELERTRRQGAYGGLLNNSNSLLSGNVMNAGIATFEMEYELWVAEQRKKDDDLRKVLMTHTNDIELRMFVDCGLNHYYDLFRMKADAAKADVFYLLNGLWRTPVERFFQWIGGFRPSELLYILIPQIELTDTQLVKARGLRQSCEQAEEAL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G102630`
TK1151 ID	TkA04G102630
OH-1004 ID	LXL04_031192
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	68.100
Protein coverage (%)	TK1151 98.329 / OH-1004 98.626 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G102630

Location Chr04:26682098-26685126 (-)

Description Similar to TGA1: Transcription factor TGA1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g65210`	Transcriptional activator that binds specifically to the DNA sequence 5'-TGACG-3'.	No verified direct reference in this release
`At5g10030`	Transcriptional activator that binds specifically to the DNA sequence 5'-TGACG-3'.	No verified direct reference in this release
`At1g22070`	Transcriptional activator that binds specifically to the DNA sequence 5'-TGACG-3'.	Salicylic acid and NPR1 induce the recruitment of trans-activating TGA factors to a defense gene promoter in Arabidopsis.2003 · DOI: 10.1105/tpc.012211
`At1g77920`	Transcriptional activator that binds specifically to the DNA sequence 5'-TGACG-3'.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031192 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0009862 systemic acquired resistance, salicylic acid mediated signaling pathway Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0005516 calmodulin binding Molecular Function

GO:0043565 sequence-specific DNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G22070

ath:AT1G77920

ath:AT5G10030

ath:AT5G65210

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.729

Rank 1 · TkA04G102630 · TK1151

Cytoplasm0.297

Rank 2 · TkA04G102630 · TK1151

Cell membrane0.059

Rank 3 · TkA04G102630 · TK1151

Endoplasmic reticulum0.039

Rank 4 · TkA04G102630 · TK1151

Mitochondrion0.026

Rank 5 · TkA04G102630 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00170bZIP_171-108 aa

PF28673bZIP_CREBRF_C71-114 aa

PF07716bZIP_272-113 aa

PF14144DOG1160-233 aa

PF28673bZIP_CREBRF_C247-278 aa

PF02120Flg_hook254-274 aa

PF00170bZIP_1258-271 aa

PF02120Flg_hook275-316 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G102630	`PF00170`	bZIP_1	71	108	8.2e-08	33.0
TkA04G102630	`PF28673`	bZIP_CREBRF_C	71	114	0.1	13.7
TkA04G102630	`PF07716`	bZIP_2	72	113	7.5e-05	23.4
TkA04G102630	`PF14144`	DOG1	160	233	2.6e-25	89.1
TkA04G102630	`PF28673`	bZIP_CREBRF_C	247	278	0.1	13.7
TkA04G102630	`PF02120`	Flg_hook	254	274	1.2	9.7
TkA04G102630	`PF00170`	bZIP_1	258	271	8.2e-08	33.0
TkA04G102630	`PF02120`	Flg_hook	275	316	1.2	9.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q39237`	Arabidopsis thaliana	sp\|Q39237\|TGA1_ARATH Transcription factor TGA1	55.400%	Swiss-Prot	High
`Q39162`	Arabidopsis thaliana	sp\|Q39162\|TGA4_ARATH Transcription factor TGA4	55.200%	Swiss-Prot	High
`Q39234`	Arabidopsis thaliana	sp\|Q39234\|TGA3_ARATH Transcription factor TGA3	54.500%	Swiss-Prot	High
`Q93ZE2`	Arabidopsis thaliana	sp\|Q93ZE2\|TGA7_ARATH Transcription factor TGA7	54.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card