TkA04G070990 | RubberDandelionOmics

Gene overview

TkA04G070990

Reference: TK1151 Chr: Chr04 Coordinates: 18810062-18813665 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1924 bp · TkA04G070990|TK1151|cDNA

CGTGTCTCCAACTTTACACTAATTATCAAACAATTAACCTAACAACTTCACAATACATCTGACACCAAAATTCTATGAATGTAGCTGTAATTGAAGAAGAATTTAGCTATGACGGGAATGAAAATCGACGAAGAATTTGTGCCTGATAGGCGTATTGAGGTTGAAACAGATGATGAAGAAAACGAAGCGGAAATTCATTGCGATGGCGAGGATAATGACGATGATGAAACCGGATCCGACAGTGAATTAATCTCCGCTCA...

CDS

Download CDS FASTA

1641 bp · TkA04G070990|TK1151|CDS

ATGACGGGAATGAAAATCGACGAAGAATTTGTGCCTGATAGGCGTATTGAGGTTGAAACAGATGATGAAGAAAACGAAGCGGAAATTCATTGCGATGGCGAGGATAATGACGATGATGAAACCGGATCCGACAGTGAATTAATCTCCGCTCAAAACAATTCCGGCTTCTTCACCGCTTCTCAATCTCAAGCCTGTAGCAATGAGCCCTGGCCGCAAACTTACAGGCAGTCAATGGACATGTACACAATGCCTCTTCATTC...

Protein

Download Protein FASTA

546 aa · TkA04G070990|TK1151|PROTEIN

MTGMKIDEEFVPDRRIEVETDDEENEAEIHCDGEDNDDDETGSDSELISAQNNSGFFTASQSQACSNEPWPQTYRQSMDMYTMPLHSMGTLKGASEFNLNLPIKRSFGPENDQSTLEKPLITESSLDKDQVPISTLPMKFSRTSALRISGLQDLPPIEQCSFSQSVLNAINVLCGIGLLSMPYAFKEGGWLCLLLLLLGGGISCYTGVLIKLCLERYDGLQTYPDIGQAAFGFVGRICIALVLYLELFSSCVEYLIMMND...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G070990`
TK1151 ID	TkA04G070990
OH-1004 ID	LXL04_012573
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	48.800
Protein coverage (%)	TK1151 87.546 / OH-1004 89.636 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G070990

Location Chr04:18810062-18813665 (+)

Description Similar to AVT1C: Amino acid transporter AVT1C

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g02180`	Amino acid transporter AVT1D.	No verified direct reference in this release
`At5g02170`	Amino acid transporter AVT1E.	No verified direct reference in this release
`At3g09330`	Amino acid transporter AVT1G.	No verified direct reference in this release
`At3g09340`	Amino acid transporter AVT1F.	No verified direct reference in this release
`At2g39130`	Amino acid transporter AVT1C.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012573 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0003333 amino acid transmembrane transport Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0031090 organelle membrane Cellular Component

GO:0015171 amino acid transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT2G39130

ath:AT3G09340

ath:AT3G54830

ath:AT5G02170

ath:AT5G02180

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.461

Rank 1 · TkA04G070990 · TK1151

Cell membrane0.210

Rank 2 · TkA04G070990 · TK1151

Cytoplasm0.184

Rank 3 · TkA04G070990 · TK1151

Endoplasmic reticulum0.144

Rank 4 · TkA04G070990 · TK1151

Golgi apparatus0.143

Rank 5 · TkA04G070990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01490Aa_trans160-540 aa

PF04647AgrB273-322 aa

PF19382DUF5957274-314 aa

PF19382DUF5957316-340 aa

PF04647AgrB380-391 aa

PF19382DUF5957383-410 aa

PF04647AgrB468-501 aa

PF19382DUF5957478-497 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G070990	`PF01490`	Aa_trans	160	540	1.2e-69	235.7
TkA04G070990	`PF04647`	AgrB	273	322	0.019	15.0
TkA04G070990	`PF19382`	DUF5957	274	314	0.15	13.1
TkA04G070990	`PF19382`	DUF5957	316	340	0.15	13.1
TkA04G070990	`PF04647`	AgrB	380	391	0.019	15.0
TkA04G070990	`PF19382`	DUF5957	383	410	0.15	13.1
TkA04G070990	`PF04647`	AgrB	468	501	0.019	15.0
TkA04G070990	`PF19382`	DUF5957	478	497	0.15	13.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GYS4`	Arabidopsis thaliana	sp\|Q8GYS4\|AVT1D_ARATH Amino acid transporter AVT1D	51.700%	Swiss-Prot	High
`Q8LPF4`	Arabidopsis thaliana	sp\|Q8LPF4\|AVT1E_ARATH Amino acid transporter AVT1E	51.300%	Swiss-Prot	High
`Q1PER9`	Arabidopsis thaliana	sp\|Q1PER9\|AVT1G_ARATH Amino acid transporter AVT1G	48.200%	Swiss-Prot	Medium
`F4IZW8`	Arabidopsis thaliana	sp\|F4IZW8\|AVT1F_ARATH Amino acid transporter AVT1F	49.800%	Swiss-Prot	Medium
`F4IUW3`	Arabidopsis thaliana	sp\|F4IUW3\|AVT1C_ARATH Amino acid transporter AVT1C	47.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card