TkA04G060060 | RubberDandelionOmics

Gene overview

TkA04G060060

Reference: TK1151 Chr: Chr04 Coordinates: 16025587-16026237 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

651 bp · TkA04G060060|TK1151|cDNA

ATGCCTGGAAAGCAGGTAGGAATGAGCGATGCATGTTTTCCCGACAGTCTAATTGGGAACATCCCAAACGTGTATTATTACGCAGCCAACAACCCCTCAGAAGCCACCATTGCCAAGAGAAGAAGTTACACCATCACCATCAGCTACCTCACTCCCCCTGCTGAGAACGCGGGTCTGTACAAGGGTCTGAAGCAGTTAAGTGAATTGATCGCATCCTACCAGTCTCTTAAAGACACAGGTCGCGGTCAGCAGATTGTGAA...

CDS

Download CDS FASTA

651 bp · TkA04G060060|TK1151|CDS

ATGCCTGGAAAGCAGGTAGGAATGAGCGATGCATGTTTTCCCGACAGTCTAATTGGGAACATCCCAAACGTGTATTATTACGCAGCCAACAACCCCTCAGAAGCCACCATTGCCAAGAGAAGAAGTTACACCATCACCATCAGCTACCTCACTCCCCCTGCTGAGAACGCGGGTCTGTACAAGGGTCTGAAGCAGTTAAGTGAATTGATCGCATCCTACCAGTCTCTTAAAGACACAGGTCGCGGTCAGCAGATTGTGAA...

Protein

Download Protein FASTA

216 aa · TkA04G060060|TK1151|PROTEIN

MPGKQVGMSDACFPDSLIGNIPNVYYYAANNPSEATIAKRRSYTITISYLTPPAENAGLYKGLKQLSELIASYQSLKDTGRGQQIVNSIISTAKQCNLDKDVDLPEEGVEISTKERDLVVGNVYSKIMEIESRLLPCGLHVIGEPPSAMEAVATLVNIAMVVVDRLLERQKADNGGKFPETVALVLWGTDNIKTYGESPGQVLWMIGCRPVADSLG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G060060`
TK1151 ID	TkA04G060060
OH-1004 ID	LXL04_036255
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	54.500
Protein coverage (%)	TK1151 100.000 / OH-1004 28.148 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G060060

Location Chr04:16025587-16026237 (+)

Description Similar to CHLH: Magnesium-chelatase subunit ChlH, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g13630`	Multifunctional protein involved in chlorophyll synthesis, plastid-to-nucleus retrograde signaling and abscisic acid (ABA) perception.	Arabidopsis genomes uncoupled 5 (GUN5) mutant reveals the involvement of Mg-chelatase H subunit in plastid-to-nucleus signal transduction.2001 · DOI: 10.1073/pnas.98.4.2053 The Mg-chelatase H subunit is an abscisic acid receptor.2006 · DOI: 10.1038/nature05176 The magnesium-chelatase H subunit binds abscisic acid and functions in abscisic acid signaling: new evidence in Arabidopsis.2009 · DOI: 10.1104/pp.109.140731 The Mg-chelatase H subunit of Arabidopsis antagonizes a group of WRKY transcription repressors to relieve ABA-responsive genes of inhibition.2010 · DOI: 10.1105/tpc.110.073874 Mg-chelatase H subunit affects ABA signaling in stomatal guard cells, but is not an ABA receptor in Arabidopsis thaliana.2011 · DOI: 10.1007/s10265-011-0426-x Roles of the different components of magnesium chelatase in abscisic acid signal transduction.2012 · DOI: 10.1007/s11103-012-9965-3

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: B8ANF1`	Involved in chlorophyll biosynthesis.	No verified direct reference in this release
`Os03g0323200`	Involved in chlorophyll biosynthesis.	C-terminal residues of oryza sativa GUN4 are required for the activation of the ChlH subunit of magnesium chelatase in chlorophyll synthesis.2012 · DOI: 10.1016/j.febslet.2011.12.026

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036255 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0015979 photosynthesis Biological Process

GO:0015995 chlorophyll biosynthetic process Biological Process

GO:0036070 light-independent bacteriochlorophyll biosynthetic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009706 chloroplast inner membrane Cellular Component

GO:0010007 magnesium chelatase complex Cellular Component

GO:0031969 chloroplast membrane Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT5G13630

cpc:Cpar_0728

dosa:Os03g0323200

rsp:RSP_0287

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.510

Rank 1 · TkA04G060060 · TK1151

Cytoplasm0.149

Rank 2 · TkA04G060060 · TK1151

Mitochondrion0.101

Rank 3 · TkA04G060060 · TK1151

Plastid0.085

Rank 4 · TkA04G060060 · TK1151

Nucleus0.069

Rank 5 · TkA04G060060 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02514CobN-Mg_chel1-159 aa

PF09668Asp_protease77-144 aa

PF02514CobN-Mg_chel158-214 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G060060	`PF02514`	CobN-Mg_chel	1	159	2.6e-69	234.9
TkA04G060060	`PF09668`	Asp_protease	77	144	0.011	16.7
TkA04G060060	`PF02514`	CobN-Mg_chel	158	214	2.6e-69	234.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FNB0`	Arabidopsis thaliana	sp\|Q9FNB0\|CHLH_ARATH Magnesium-chelatase subunit ChlH, chloroplastic	48.800%	Swiss-Prot	Medium
`B8ANF1`	Oryza sativa subsp. indica	sp\|B8ANF1\|CHLH_ORYSI Magnesium-chelatase subunit ChlH, chloroplastic	48.600%	Swiss-Prot	Medium
`Q10M50`	Oryza sativa subsp. japonica	sp\|Q10M50\|CHLH_ORYSJ Magnesium-chelatase subunit ChlH, chloroplastic	48.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card